Incidental Mutation 'R4183:Mcidas'
ID319836
Institutional Source Beutler Lab
Gene Symbol Mcidas
Ensembl Gene ENSMUSG00000074651
Gene Namemulticiliate differentiation and DNA synthesis associated cell cycle protein
SynonymsIdas, Mci, multicilin, Mcin, Gm6320
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location112993845-113000394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112994372 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 77 (D77G)
Ref Sequence ENSEMBL: ENSMUSP00000089721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038404] [ENSMUST00000092089]
Predicted Effect probably benign
Transcript: ENSMUST00000038404
SMART Domains Protein: ENSMUSP00000040083
Gene: ENSMUSG00000042417

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 30 46 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
CYCLIN 140 224 1.23e-19 SMART
Cyclin_C 233 350 3.49e-7 SMART
CYCLIN 244 327 5.77e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092089
AA Change: D77G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089721
Gene: ENSMUSG00000074651
AA Change: D77G

DomainStartEndE-ValueType
low complexity region 60 73 N/A INTRINSIC
Pfam:Geminin 169 258 4.8e-20 PFAM
low complexity region 262 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225555
Meta Mutation Damage Score 0.0899 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the geminin family of proteins. The encoded nuclear protein is required for the generation of multiciliated cells in respiratory epithelium. Mutations in this gene cause a rare mucociliary clearance disorder associated with recurring respiratory infections in human patients, known as reduced generation of multiple motile cilia (RGMC). [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Mcidas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Mcidas APN 13 112997585 splice site probably benign
IGL01355:Mcidas APN 13 112999069 missense probably damaging 1.00
IGL02000:Mcidas APN 13 112997440 missense probably benign
IGL02019:Mcidas APN 13 112996843 missense probably benign 0.00
R0145:Mcidas UTSW 13 112994372 missense probably damaging 1.00
R0412:Mcidas UTSW 13 112999143 missense probably damaging 1.00
R1293:Mcidas UTSW 13 112997392 missense probably benign
R2011:Mcidas UTSW 13 112993981 missense possibly damaging 0.84
R4905:Mcidas UTSW 13 112994417 missense possibly damaging 0.84
R4905:Mcidas UTSW 13 112997504 missense possibly damaging 0.82
R5615:Mcidas UTSW 13 112997425 missense probably benign 0.01
R5997:Mcidas UTSW 13 112998586 missense probably damaging 0.99
R6848:Mcidas UTSW 13 112993885 missense probably benign
R7387:Mcidas UTSW 13 112994088 missense probably benign 0.03
R7398:Mcidas UTSW 13 112996882 missense probably benign
R7742:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7795:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7797:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7872:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7873:Mcidas UTSW 13 112998987 missense probably damaging 1.00
R7920:Mcidas UTSW 13 112998987 missense probably damaging 1.00
X0066:Mcidas UTSW 13 112997447 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAACCCGATTATCCATGCCG -3'
(R):5'- GCTCTGGAAACGAGAACTTAAGC -3'

Sequencing Primer
(F):5'- CGATTATCCATGCCGGGTGG -3'
(R):5'- GTGCTCCCAGTCCATCTTGAGAC -3'
Posted On2015-06-10