Incidental Mutation 'R4183:Mapk8'
ID319837
Institutional Source Beutler Lab
Gene Symbol Mapk8
Ensembl Gene ENSMUSG00000021936
Gene Namemitogen-activated protein kinase 8
SynonymsJNK1, c-Jun N-terminal kinase, Prkm8
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location33377898-33447158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33382220 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 413 (D413G)
Ref Sequence ENSEMBL: ENSMUSP00000107575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022504] [ENSMUST00000111942] [ENSMUST00000111943] [ENSMUST00000111944] [ENSMUST00000111945]
Predicted Effect probably damaging
Transcript: ENSMUST00000022504
AA Change: D413G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022504
Gene: ENSMUSG00000021936
AA Change: D413G

DomainStartEndE-ValueType
S_TKc 26 321 1.3e-86 SMART
low complexity region 390 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111942
SMART Domains Protein: ENSMUSP00000107573
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 26 208 1.8e-25 PFAM
Pfam:Pkinase 26 210 5.2e-48 PFAM
Pfam:Kdo 33 178 6.4e-9 PFAM
SCOP:d1pme__ 216 286 2e-17 SMART
PDB:3GP0|A 218 288 4e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000111943
SMART Domains Protein: ENSMUSP00000107574
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
S_TKc 26 321 1.3e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111944
AA Change: D413G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107575
Gene: ENSMUSG00000021936
AA Change: D413G

DomainStartEndE-ValueType
S_TKc 26 321 1.06e-86 SMART
low complexity region 390 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111945
SMART Domains Protein: ENSMUSP00000107576
Gene: ENSMUSG00000021936

DomainStartEndE-ValueType
S_TKc 26 321 1.06e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150659
Meta Mutation Damage Score 0.1376 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is activated by various cell stimuli, and targets specific transcription factors, and thus mediates immediate-early gene expression in response to cell stimuli. The activation of this kinase by tumor-necrosis factor alpha (TNF-alpha) is found to be required for TNF-alpha induced apoptosis. This kinase is also involved in UV radiation induced apoptosis, which is thought to be related to cytochrom c-mediated cell death pathway. Studies of the mouse counterpart of this gene suggested that this kinase play a key role in T cell proliferation, apoptosis and differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal T cell differentiation and proliferation, cardiac morphology and physiology, and chemically-induced tumorigenesis. Mice homozygous for another knock-out allele exhibit abnormal glucose homeostasis and T cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Mapk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Mapk8 APN 14 33383900 missense probably benign 0.01
R0255:Mapk8 UTSW 14 33387307 splice site probably benign
R0401:Mapk8 UTSW 14 33382208 missense probably benign 0.37
R0862:Mapk8 UTSW 14 33392992 missense probably damaging 0.98
R0864:Mapk8 UTSW 14 33392992 missense probably damaging 0.98
R1084:Mapk8 UTSW 14 33388803 nonsense probably null
R1637:Mapk8 UTSW 14 33410962 missense probably benign 0.00
R2038:Mapk8 UTSW 14 33388936 nonsense probably null
R3959:Mapk8 UTSW 14 33382253 missense probably null 0.21
R4087:Mapk8 UTSW 14 33390248 missense probably benign 0.00
R4181:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R4184:Mapk8 UTSW 14 33382220 missense probably damaging 1.00
R5366:Mapk8 UTSW 14 33390729 missense probably damaging 1.00
R6076:Mapk8 UTSW 14 33390293 missense probably damaging 1.00
R6991:Mapk8 UTSW 14 33410884 missense possibly damaging 0.82
R7345:Mapk8 UTSW 14 33408111 missense probably damaging 0.99
R7814:Mapk8 UTSW 14 33410877 nonsense probably null
R8194:Mapk8 UTSW 14 33382284 missense probably benign
Z1176:Mapk8 UTSW 14 33410886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTCACCACATAATAGTTGC -3'
(R):5'- AGCCCAGGAGAAGTCTATAGAC -3'

Sequencing Primer
(F):5'- CAGTTTTGTTGCTGTTTAAAAACAC -3'
(R):5'- CCAGGAGAAGTCTATAGACCCTGAAG -3'
Posted On2015-06-10