Incidental Mutation 'R4183:Olfr97'
ID319844
Institutional Source Beutler Lab
Gene Symbol Olfr97
Ensembl Gene ENSMUSG00000058802
Gene Nameolfactory receptor 97
SynonymsMOR156-2, GA_x6K02T2PSCP-1672287-1671355
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37230963-37237330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37231848 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 174 (H174P)
Ref Sequence ENSEMBL: ENSMUSP00000151044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073667] [ENSMUST00000207414] [ENSMUST00000213328] [ENSMUST00000214622] [ENSMUST00000214848] [ENSMUST00000216225]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073667
AA Change: H174P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094937
Gene: ENSMUSG00000058802
AA Change: H174P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 24 305 4.5e-9 PFAM
Pfam:7tm_4 29 306 1.4e-54 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1.1e-5 PFAM
Pfam:7tm_1 39 288 8.6e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207414
AA Change: H174P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213328
AA Change: H174P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214622
AA Change: H174P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214848
AA Change: H174P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216225
AA Change: H174P

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.3178 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Bicral T C 17: 46,814,029 K615E probably damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Olfr97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Olfr97 APN 17 37231548 missense probably damaging 1.00
IGL02424:Olfr97 APN 17 37232372 start gained probably benign
IGL03129:Olfr97 APN 17 37232196 missense probably damaging 1.00
R0619:Olfr97 UTSW 17 37232155 missense possibly damaging 0.92
R0811:Olfr97 UTSW 17 37232332 missense probably benign 0.00
R0812:Olfr97 UTSW 17 37232332 missense probably benign 0.00
R1122:Olfr97 UTSW 17 37232043 missense probably damaging 1.00
R1927:Olfr97 UTSW 17 37231543 missense probably damaging 1.00
R1997:Olfr97 UTSW 17 37231632 missense probably damaging 1.00
R3771:Olfr97 UTSW 17 37231465 missense possibly damaging 0.53
R3775:Olfr97 UTSW 17 37232230 missense probably damaging 0.98
R4182:Olfr97 UTSW 17 37231848 missense possibly damaging 0.93
R4184:Olfr97 UTSW 17 37231848 missense possibly damaging 0.93
R4198:Olfr97 UTSW 17 37232134 missense probably benign 0.01
R7453:Olfr97 UTSW 17 37231980 missense probably damaging 1.00
R7615:Olfr97 UTSW 17 37231450 missense probably benign 0.25
R7829:Olfr97 UTSW 17 37232310 missense probably benign 0.01
R8223:Olfr97 UTSW 17 37231836 missense possibly damaging 0.89
Z1177:Olfr97 UTSW 17 37232296 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAACTGCATGTAGCCAAGG -3'
(R):5'- ACATGGATAACCTGCTTCTAGC -3'

Sequencing Primer
(F):5'- TTTCCTTTTTCCCTGTGCTGATGG -3'
(R):5'- AGCAGTCATGGCTATTGACC -3'
Posted On2015-06-10