Incidental Mutation 'R4183:Bicral'
ID319845
Institutional Source Beutler Lab
Gene Symbol Bicral
Ensembl Gene ENSMUSG00000036568
Gene NameBRD4 interacting chromatin remodeling complex associated protein like
SynonymsBC032203, Gltscr1l
MMRRC Submission 041019-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4183 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46798116-46831413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46814029 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 615 (K615E)
Ref Sequence ENSEMBL: ENSMUSP00000044833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040624]
Predicted Effect probably damaging
Transcript: ENSMUST00000040624
AA Change: K615E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044833
Gene: ENSMUSG00000036568
AA Change: K615E

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Pfam:GLTSCR1 701 808 4.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal embryo turning, embryonic growth retardation, cardiac hypertrophy, and complete embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 T C 8: 122,899,676 I198V possibly damaging Het
Arhgap12 T C 18: 6,111,734 D210G probably damaging Het
Arpc2 T A 1: 74,248,163 N31K probably damaging Het
Atp11a T A 8: 12,816,990 V139D possibly damaging Het
Ccdc27 TTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTC 4: 154,036,306 probably benign Het
Chrnb1 T C 11: 69,787,096 M277V possibly damaging Het
Csmd1 C T 8: 15,910,464 C3317Y probably damaging Het
Ddx1 A T 12: 13,231,503 L353* probably null Het
Degs2 T C 12: 108,692,099 K207R probably damaging Het
Fam167a T C 14: 63,452,320 V22A probably benign Het
Fam186a G A 15: 99,933,685 probably benign Het
Gprc5b T C 7: 118,984,526 D40G probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Inpp5j A G 11: 3,501,134 I505T probably damaging Het
Lurap1l G A 4: 80,953,858 S196N probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mapkbp1 A G 2: 120,017,865 D632G probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mdga1 A G 17: 29,969,990 V33A unknown Het
Me3 A G 7: 89,851,830 D583G probably benign Het
Mndal T A 1: 173,875,771 T23S possibly damaging Het
Myh13 T C 11: 67,349,610 M780T possibly damaging Het
Nat10 A G 2: 103,739,813 L395P probably damaging Het
Naxd T C 8: 11,502,757 V59A probably damaging Het
Nbeal2 A T 9: 110,636,675 V876E probably benign Het
Olfr1238 T C 2: 89,406,591 T163A probably benign Het
Olfr150 A G 9: 39,737,048 T78A probably benign Het
Olfr624 T C 7: 103,670,971 Y20C possibly damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk4 C T 10: 80,325,011 R327Q probably benign Het
Pkhd1 C T 1: 20,117,807 V3426I probably benign Het
Ranbp2 T C 10: 58,465,666 F687L possibly damaging Het
Rb1 A G 14: 73,198,526 probably null Het
Tfpi2 C A 6: 3,963,926 V51L probably damaging Het
Tnn T C 1: 160,097,355 D1143G probably damaging Het
Ttn A G 2: 76,711,242 M25473T probably benign Het
Vmn1r201 A G 13: 22,474,852 I79V probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wdr25 T A 12: 109,027,331 F491Y probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Other mutations in Bicral
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Bicral APN 17 46825352 missense probably benign 0.01
IGL01068:Bicral APN 17 46825391 missense probably damaging 1.00
IGL01899:Bicral APN 17 46824674 missense probably benign 0.08
IGL02321:Bicral APN 17 46811947 missense probably benign 0.01
IGL02425:Bicral APN 17 46808454 missense probably benign 0.05
R0091:Bicral UTSW 17 46825307 missense probably damaging 1.00
R0268:Bicral UTSW 17 46814052 splice site probably benign
R0344:Bicral UTSW 17 46814052 splice site probably benign
R0508:Bicral UTSW 17 46825401 missense possibly damaging 0.61
R0589:Bicral UTSW 17 46801596 missense probably benign 0.00
R1442:Bicral UTSW 17 46801724 missense probably benign 0.05
R1468:Bicral UTSW 17 46824593 missense probably benign 0.00
R1468:Bicral UTSW 17 46824593 missense probably benign 0.00
R1874:Bicral UTSW 17 46825178 missense probably benign 0.30
R2057:Bicral UTSW 17 46824888 missense possibly damaging 0.69
R2120:Bicral UTSW 17 46824815 missense probably benign 0.02
R2190:Bicral UTSW 17 46825123 missense probably damaging 0.98
R3737:Bicral UTSW 17 46825910 missense probably damaging 1.00
R3961:Bicral UTSW 17 46824825 missense probably damaging 0.96
R3977:Bicral UTSW 17 46830991 start codon destroyed unknown
R3979:Bicral UTSW 17 46830991 start codon destroyed unknown
R4876:Bicral UTSW 17 46825576 missense probably damaging 1.00
R5104:Bicral UTSW 17 46801256 missense probably damaging 0.98
R5310:Bicral UTSW 17 46813983 missense possibly damaging 0.89
R5493:Bicral UTSW 17 46801694 missense possibly damaging 0.77
R5610:Bicral UTSW 17 46808492 missense probably damaging 0.99
R5656:Bicral UTSW 17 46808369 missense probably damaging 0.99
R5771:Bicral UTSW 17 46825358 missense possibly damaging 0.59
R5891:Bicral UTSW 17 46801229 missense probably benign
R6426:Bicral UTSW 17 46830079 missense probably benign 0.36
R6497:Bicral UTSW 17 46825573 missense probably damaging 1.00
R7025:Bicral UTSW 17 46801668 missense probably benign
R7037:Bicral UTSW 17 46824634 missense probably benign 0.08
R7440:Bicral UTSW 17 46825784 missense probably damaging 1.00
R7997:Bicral UTSW 17 46801608 missense probably benign 0.37
V3553:Bicral UTSW 17 46830095 missense probably damaging 1.00
X0019:Bicral UTSW 17 46825821 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAATGCCATGCTCCAGGAAC -3'
(R):5'- AAAGGATCTCTTGTCTTCTTTTGGC -3'

Sequencing Primer
(F):5'- TGCTCCAGGAACGCAAAAACAG -3'
(R):5'- CACAGTGTAGACACATAGACA -3'
Posted On2015-06-10