Incidental Mutation 'R4184:Chil4'
ID 319854
Institutional Source Beutler Lab
Gene Symbol Chil4
Ensembl Gene ENSMUSG00000063779
Gene Name chitinase-like 4
Synonyms Chi3l4, Ym2
MMRRC Submission 041020-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4184 (G1)
Quality Score 150
Status Validated
Chromosome 3
Chromosomal Location 106108807-106126795 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 106111043 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 284 (P284S)
Ref Sequence ENSEMBL: ENSMUSP00000080851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082219]
AlphaFold Q91Z98
Predicted Effect possibly damaging
Transcript: ENSMUST00000082219
AA Change: P284S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: P284S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.77e-132 SMART
Meta Mutation Damage Score 0.6164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acte1 A T 7: 143,447,858 (GRCm39) K234* probably null Het
Ccdc178 A G 18: 22,157,841 (GRCm39) L539P probably damaging Het
Cd5 T A 19: 10,698,638 (GRCm39) N423I probably damaging Het
Ceacam20 C T 7: 19,710,041 (GRCm39) T355I probably damaging Het
Cln8 T C 8: 14,945,030 (GRCm39) F115L probably benign Het
Cpne9 T A 6: 113,259,418 (GRCm39) probably benign Het
Cyp4a32 C T 4: 115,478,720 (GRCm39) T484I possibly damaging Het
Des C G 1: 75,339,228 (GRCm39) A251G probably benign Het
Dnah3 T C 7: 119,682,516 (GRCm39) D270G probably damaging Het
Epc1 T C 18: 6,453,578 (GRCm39) E249G possibly damaging Het
Fsbp T A 4: 11,584,058 (GRCm39) N252K probably benign Het
Gramd1a C A 7: 30,831,940 (GRCm39) probably benign Het
Grsf1 G A 5: 88,812,015 (GRCm39) P271S probably benign Het
Igsf10 C T 3: 59,227,152 (GRCm39) V2174M probably damaging Het
Kcnu1 T C 8: 26,352,445 (GRCm39) L204P probably damaging Het
Kdm7a T C 6: 39,125,911 (GRCm39) E628G probably benign Het
Klhl36 T C 8: 120,601,124 (GRCm39) M381T probably damaging Het
Kpna3 A T 14: 61,605,624 (GRCm39) Y474N probably damaging Het
Lsm8 G T 6: 18,849,604 (GRCm39) probably benign Het
Mapk8 T C 14: 33,104,177 (GRCm39) D413G probably damaging Het
Mbd2 T A 18: 70,751,050 (GRCm39) C362S probably damaging Het
Mex3b A G 7: 82,519,238 (GRCm39) R518G probably benign Het
Mical1 T C 10: 41,357,866 (GRCm39) probably benign Het
Myo18a T C 11: 77,748,613 (GRCm39) S1996P probably damaging Het
Or11g7 A G 14: 50,690,827 (GRCm39) Y106C probably damaging Het
Or11h4b C G 14: 50,918,507 (GRCm39) E195Q probably benign Het
Or1o2 T G 17: 37,542,739 (GRCm39) H174P possibly damaging Het
Otop2 T A 11: 115,220,671 (GRCm39) C504S probably benign Het
Pkhd1 T A 1: 20,279,501 (GRCm39) H2939L probably benign Het
Pkhd1 C T 1: 20,633,910 (GRCm39) V542M probably benign Het
Pkhd1l1 C T 15: 44,455,302 (GRCm39) T4021I probably benign Het
Prr36 T C 8: 4,263,409 (GRCm39) probably benign Het
Ptchd4 A T 17: 42,813,650 (GRCm39) Y517F probably damaging Het
Pth1r A G 9: 110,571,300 (GRCm39) M1T probably null Het
Rdx C A 9: 51,978,680 (GRCm39) L163M probably damaging Het
Reep6 A G 10: 80,169,648 (GRCm39) Y112C probably damaging Het
Rpp21 A G 17: 36,568,611 (GRCm39) probably benign Het
Sacs T A 14: 61,451,393 (GRCm39) C4480S probably damaging Het
Slc15a1 G A 14: 121,703,574 (GRCm39) T512I probably benign Het
Slc22a22 A T 15: 57,119,962 (GRCm39) C170* probably null Het
Slc26a2 C T 18: 61,331,904 (GRCm39) R509K probably benign Het
Slc4a10 A G 2: 62,147,786 (GRCm39) probably benign Het
Stc1 A T 14: 69,266,834 (GRCm39) probably benign Het
Tbc1d32 T A 10: 56,100,676 (GRCm39) T101S probably benign Het
Tsc2 T C 17: 24,850,990 (GRCm39) T23A probably benign Het
Vmn1r52 T G 6: 90,156,219 (GRCm39) F174L probably benign Het
Zfp972 G A 2: 177,563,250 (GRCm39) Q56* probably null Het
Zfp982 A G 4: 147,597,150 (GRCm39) K169R probably benign Het
Zfpl1 A G 19: 6,131,170 (GRCm39) L274P probably damaging Het
Other mutations in Chil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Chil4 APN 3 106,109,113 (GRCm39) missense probably benign
IGL02457:Chil4 APN 3 106,121,715 (GRCm39) missense probably benign
R1087:Chil4 UTSW 3 106,117,881 (GRCm39) missense probably benign 0.01
R1398:Chil4 UTSW 3 106,126,825 (GRCm39) splice site probably null
R1503:Chil4 UTSW 3 106,113,350 (GRCm39) missense probably benign
R1553:Chil4 UTSW 3 106,111,006 (GRCm39) missense probably benign 0.02
R1806:Chil4 UTSW 3 106,117,959 (GRCm39) splice site probably benign
R1873:Chil4 UTSW 3 106,113,414 (GRCm39) missense probably benign 0.00
R2069:Chil4 UTSW 3 106,126,771 (GRCm39) missense probably benign 0.16
R2100:Chil4 UTSW 3 106,121,663 (GRCm39) missense probably benign
R2370:Chil4 UTSW 3 106,121,616 (GRCm39) nonsense probably null
R2984:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R2985:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R3522:Chil4 UTSW 3 106,111,056 (GRCm39) missense probably benign 0.08
R3919:Chil4 UTSW 3 106,109,848 (GRCm39) missense probably benign 0.00
R4033:Chil4 UTSW 3 106,121,765 (GRCm39) missense probably damaging 1.00
R4181:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4301:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4347:Chil4 UTSW 3 106,110,144 (GRCm39) missense probably benign
R4391:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4395:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4418:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4483:Chil4 UTSW 3 106,121,678 (GRCm39) missense probably damaging 1.00
R4544:Chil4 UTSW 3 106,117,922 (GRCm39) missense probably damaging 0.97
R4887:Chil4 UTSW 3 106,111,460 (GRCm39) missense probably benign 0.01
R4949:Chil4 UTSW 3 106,113,408 (GRCm39) missense possibly damaging 0.83
R5076:Chil4 UTSW 3 106,109,913 (GRCm39) missense probably damaging 1.00
R5146:Chil4 UTSW 3 106,110,150 (GRCm39) missense probably benign 0.18
R5254:Chil4 UTSW 3 106,126,768 (GRCm39) missense probably benign 0.00
R5521:Chil4 UTSW 3 106,111,013 (GRCm39) missense possibly damaging 0.50
R5790:Chil4 UTSW 3 106,109,894 (GRCm39) missense probably benign 0.00
R5883:Chil4 UTSW 3 106,117,886 (GRCm39) missense possibly damaging 0.48
R6010:Chil4 UTSW 3 106,121,711 (GRCm39) missense probably damaging 1.00
R6257:Chil4 UTSW 3 106,111,412 (GRCm39) missense possibly damaging 0.84
R6269:Chil4 UTSW 3 106,111,487 (GRCm39) missense probably damaging 1.00
R6602:Chil4 UTSW 3 106,117,906 (GRCm39) missense probably benign 0.00
R7113:Chil4 UTSW 3 106,121,664 (GRCm39) missense probably benign
R7113:Chil4 UTSW 3 106,110,083 (GRCm39) missense probably damaging 1.00
R7188:Chil4 UTSW 3 106,111,475 (GRCm39) missense probably damaging 1.00
R7980:Chil4 UTSW 3 106,110,060 (GRCm39) missense probably damaging 1.00
R8810:Chil4 UTSW 3 106,109,121 (GRCm39) missense probably damaging 0.99
R9300:Chil4 UTSW 3 106,109,874 (GRCm39) missense probably benign 0.10
R9307:Chil4 UTSW 3 106,111,382 (GRCm39) critical splice donor site probably null
R9529:Chil4 UTSW 3 106,118,656 (GRCm39) missense probably damaging 1.00
X0067:Chil4 UTSW 3 106,113,350 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATGTTGTATCTGCTTAGGAAGAGTAC -3'
(R):5'- TTCACACAATTTGAGATACAAGAGGGG -3'

Sequencing Primer
(F):5'- TCTGCTTAGGAAGAGTACATACTG -3'
(R):5'- AGGGGAGAACTAACCTATATAAACAC -3'
Posted On 2015-06-10