Incidental Mutation 'R4184:Gramd1a'
ID319864
Institutional Source Beutler Lab
Gene Symbol Gramd1a
Ensembl Gene ENSMUSG00000001248
Gene NameGRAM domain containing 1A
SynonymsD7Bwg0611e, 1300003M23Rik
MMRRC Submission 041020-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R4184 (G1)
Quality Score161
Status Validated
Chromosome7
Chromosomal Location31130127-31155896 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 31132515 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000001280] [ENSMUST00000085636] [ENSMUST00000186634]
Predicted Effect probably benign
Transcript: ENSMUST00000001280
SMART Domains Protein: ENSMUSP00000001280
Gene: ENSMUSG00000001248

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 520 7.3e-37 PFAM
low complexity region 531 542 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
transmembrane domain 606 628 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085636
SMART Domains Protein: ENSMUSP00000082778
Gene: ENSMUSG00000001248

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 500 1.1e-28 PFAM
low complexity region 514 528 N/A INTRINSIC
transmembrane domain 572 594 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185985
Predicted Effect probably benign
Transcript: ENSMUST00000186634
SMART Domains Protein: ENSMUSP00000140195
Gene: ENSMUSG00000001248

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 8.9e-32 SMART
low complexity region 342 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188032
Predicted Effect probably benign
Transcript: ENSMUST00000202814
Predicted Effect probably benign
Transcript: ENSMUST00000206233
Predicted Effect probably benign
Transcript: ENSMUST00000206432
Predicted Effect probably benign
Transcript: ENSMUST00000220635
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc178 A G 18: 22,024,784 L539P probably damaging Het
Cd5 T A 19: 10,721,274 N423I probably damaging Het
Ceacam20 C T 7: 19,976,116 T355I probably damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cln8 T C 8: 14,895,030 F115L probably benign Het
Cpne9 T A 6: 113,282,457 probably benign Het
Cyp4a32 C T 4: 115,621,523 T484I possibly damaging Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnah3 T C 7: 120,083,293 D270G probably damaging Het
Epc1 T C 18: 6,453,578 E249G possibly damaging Het
Fsbp T A 4: 11,584,058 N252K probably benign Het
Gm498 A T 7: 143,894,121 K234* probably null Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Igsf10 C T 3: 59,319,731 V2174M probably damaging Het
Kcnu1 T C 8: 25,862,417 L204P probably damaging Het
Kdm7a T C 6: 39,148,977 E628G probably benign Het
Klhl36 T C 8: 119,874,385 M381T probably damaging Het
Kpna3 A T 14: 61,368,175 Y474N probably damaging Het
Lsm8 G T 6: 18,849,605 probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mbd2 T A 18: 70,617,979 C362S probably damaging Het
Mex3b A G 7: 82,870,030 R518G probably benign Het
Mical1 T C 10: 41,481,870 probably benign Het
Myo18a T C 11: 77,857,787 S1996P probably damaging Het
Olfr740 A G 14: 50,453,370 Y106C probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Otop2 T A 11: 115,329,845 C504S probably benign Het
Pkhd1 T A 1: 20,209,277 H2939L probably benign Het
Pkhd1 C T 1: 20,563,686 V542M probably benign Het
Pkhd1l1 C T 15: 44,591,906 T4021I probably benign Het
Prr36 T C 8: 4,213,409 probably benign Het
Ptchd4 A T 17: 42,502,759 Y517F probably damaging Het
Pth1r A G 9: 110,742,232 M1T probably null Het
Rdx C A 9: 52,067,380 L163M probably damaging Het
Reep6 A G 10: 80,333,814 Y112C probably damaging Het
Rpp21 A G 17: 36,257,719 probably benign Het
Sacs T A 14: 61,213,944 C4480S probably damaging Het
Slc15a1 G A 14: 121,466,162 T512I probably benign Het
Slc22a22 A T 15: 57,256,566 C170* probably null Het
Slc26a2 C T 18: 61,198,832 R509K probably benign Het
Slc4a10 A G 2: 62,317,442 probably benign Het
Stc1 A T 14: 69,029,385 probably benign Het
Tbc1d32 T A 10: 56,224,580 T101S probably benign Het
Tsc2 T C 17: 24,632,016 T23A probably benign Het
Vmn1r52 T G 6: 90,179,237 F174L probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Zfpl1 A G 19: 6,081,140 L274P probably damaging Het
Other mutations in Gramd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Gramd1a APN 7 31142568 missense probably damaging 0.99
IGL01627:Gramd1a APN 7 31139796 missense probably damaging 0.99
IGL01684:Gramd1a APN 7 31138905 missense possibly damaging 0.67
IGL01793:Gramd1a APN 7 31134413 critical splice donor site probably null
IGL01986:Gramd1a APN 7 31134009 missense possibly damaging 0.58
IGL02029:Gramd1a APN 7 31132824 missense possibly damaging 0.95
IGL02060:Gramd1a APN 7 31130571 nonsense probably null
IGL02569:Gramd1a APN 7 31130507 unclassified probably benign
IGL02606:Gramd1a APN 7 31134515 missense probably damaging 1.00
IGL02715:Gramd1a APN 7 31135854 missense probably damaging 1.00
IGL03253:Gramd1a APN 7 31139846 nonsense probably null
PIT4377001:Gramd1a UTSW 7 31143670 missense possibly damaging 0.95
PIT4618001:Gramd1a UTSW 7 31132596 missense probably benign 0.00
R0179:Gramd1a UTSW 7 31142418 missense probably damaging 1.00
R0329:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0330:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0628:Gramd1a UTSW 7 31142624 missense probably damaging 1.00
R0834:Gramd1a UTSW 7 31138164 missense possibly damaging 0.94
R1421:Gramd1a UTSW 7 31142866 missense probably damaging 0.98
R1430:Gramd1a UTSW 7 31132786 missense probably damaging 0.97
R1682:Gramd1a UTSW 7 31142900 splice site probably null
R1703:Gramd1a UTSW 7 31139534 missense possibly damaging 0.96
R1822:Gramd1a UTSW 7 31142573 missense probably damaging 1.00
R2308:Gramd1a UTSW 7 31139790 missense probably damaging 0.97
R3861:Gramd1a UTSW 7 31135940 missense possibly damaging 0.90
R4908:Gramd1a UTSW 7 31138867 missense probably benign 0.27
R4978:Gramd1a UTSW 7 31132788 missense possibly damaging 0.74
R5723:Gramd1a UTSW 7 31134483 missense probably damaging 1.00
R5927:Gramd1a UTSW 7 31139821 missense probably benign 0.33
R6466:Gramd1a UTSW 7 31143796 missense probably benign
R6838:Gramd1a UTSW 7 31134504 missense probably benign 0.30
R7034:Gramd1a UTSW 7 31132756 critical splice donor site probably null
R7036:Gramd1a UTSW 7 31132756 critical splice donor site probably null
R7867:Gramd1a UTSW 7 31143567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAGGGGATTCTTACTACAGCC -3'
(R):5'- TCAAGCACGTTAAGATGGCC -3'

Sequencing Primer
(F):5'- GGGATTCTTACTACAGCCAAATGG -3'
(R):5'- CACGTTAAGATGGCCAGGGC -3'
Posted On2015-06-10