Incidental Mutation 'R4184:Ptchd4'
ID319891
Institutional Source Beutler Lab
Gene Symbol Ptchd4
Ensembl Gene ENSMUSG00000042256
Gene Namepatched domain containing 4
Synonyms3110082D06Rik
MMRRC Submission 041020-MU
Accession Numbers

Ncbi RefSeq: NM_028474.1; MGI: 1920485

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4184 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location42315947-42507741 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42502759 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 517 (Y517F)
Ref Sequence ENSEMBL: ENSMUSP00000047640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048691]
Predicted Effect probably damaging
Transcript: ENSMUST00000048691
AA Change: Y517F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047640
Gene: ENSMUSG00000042256
AA Change: Y517F

DomainStartEndE-ValueType
Pfam:Patched 58 867 6.1e-102 PFAM
Pfam:Sterol-sensing 312 464 2.9e-26 PFAM
low complexity region 869 891 N/A INTRINSIC
Meta Mutation Damage Score 0.1874 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 95% (55/58)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc178 A G 18: 22,024,784 L539P probably damaging Het
Cd5 T A 19: 10,721,274 N423I probably damaging Het
Ceacam20 C T 7: 19,976,116 T355I probably damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cln8 T C 8: 14,895,030 F115L probably benign Het
Cpne9 T A 6: 113,282,457 probably benign Het
Cyp4a32 C T 4: 115,621,523 T484I possibly damaging Het
Des C G 1: 75,362,584 A251G probably benign Het
Dnah3 T C 7: 120,083,293 D270G probably damaging Het
Epc1 T C 18: 6,453,578 E249G possibly damaging Het
Fsbp T A 4: 11,584,058 N252K probably benign Het
Gm498 A T 7: 143,894,121 K234* probably null Het
Gramd1a C A 7: 31,132,515 probably benign Het
Grsf1 G A 5: 88,664,156 P271S probably benign Het
Igsf10 C T 3: 59,319,731 V2174M probably damaging Het
Kcnu1 T C 8: 25,862,417 L204P probably damaging Het
Kdm7a T C 6: 39,148,977 E628G probably benign Het
Klhl36 T C 8: 119,874,385 M381T probably damaging Het
Kpna3 A T 14: 61,368,175 Y474N probably damaging Het
Lsm8 G T 6: 18,849,605 probably benign Het
Mapk8 T C 14: 33,382,220 D413G probably damaging Het
Mbd2 T A 18: 70,617,979 C362S probably damaging Het
Mex3b A G 7: 82,870,030 R518G probably benign Het
Mical1 T C 10: 41,481,870 probably benign Het
Myo18a T C 11: 77,857,787 S1996P probably damaging Het
Olfr740 A G 14: 50,453,370 Y106C probably damaging Het
Olfr747 C G 14: 50,681,050 E195Q probably benign Het
Olfr97 T G 17: 37,231,848 H174P possibly damaging Het
Otop2 T A 11: 115,329,845 C504S probably benign Het
Pkhd1 T A 1: 20,209,277 H2939L probably benign Het
Pkhd1 C T 1: 20,563,686 V542M probably benign Het
Pkhd1l1 C T 15: 44,591,906 T4021I probably benign Het
Prr36 T C 8: 4,213,409 probably benign Het
Pth1r A G 9: 110,742,232 M1T probably null Het
Rdx C A 9: 52,067,380 L163M probably damaging Het
Reep6 A G 10: 80,333,814 Y112C probably damaging Het
Rpp21 A G 17: 36,257,719 probably benign Het
Sacs T A 14: 61,213,944 C4480S probably damaging Het
Slc15a1 G A 14: 121,466,162 T512I probably benign Het
Slc22a22 A T 15: 57,256,566 C170* probably null Het
Slc26a2 C T 18: 61,198,832 R509K probably benign Het
Slc4a10 A G 2: 62,317,442 probably benign Het
Stc1 A T 14: 69,029,385 probably benign Het
Tbc1d32 T A 10: 56,224,580 T101S probably benign Het
Tsc2 T C 17: 24,632,016 T23A probably benign Het
Vmn1r52 T G 6: 90,179,237 F174L probably benign Het
Zfp972 G A 2: 177,921,457 Q56* probably null Het
Zfp982 A G 4: 147,512,693 K169R probably benign Het
Zfpl1 A G 19: 6,081,140 L274P probably damaging Het
Other mutations in Ptchd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ptchd4 APN 17 42316926 nonsense probably null
IGL01360:Ptchd4 APN 17 42317045 missense probably benign 0.09
IGL01814:Ptchd4 APN 17 42503286 missense possibly damaging 0.84
IGL01885:Ptchd4 APN 17 42503602 missense probably damaging 1.00
IGL01929:Ptchd4 APN 17 42503322 missense probably benign 0.02
IGL02371:Ptchd4 APN 17 42316974 missense possibly damaging 0.83
IGL02480:Ptchd4 APN 17 42502540 missense probably benign 0.38
IGL02507:Ptchd4 APN 17 42316873 missense possibly damaging 0.72
IGL02593:Ptchd4 APN 17 42317146 missense probably benign 0.24
IGL02861:Ptchd4 APN 17 42377317 missense probably damaging 1.00
IGL02884:Ptchd4 APN 17 42502449 missense possibly damaging 0.86
IGL03384:Ptchd4 APN 17 42502590 missense probably damaging 1.00
PIT4418001:Ptchd4 UTSW 17 42503089 missense probably damaging 1.00
R0030:Ptchd4 UTSW 17 42317108 nonsense probably null
R0243:Ptchd4 UTSW 17 42503416 missense probably damaging 1.00
R0398:Ptchd4 UTSW 17 42377259 missense possibly damaging 0.95
R0513:Ptchd4 UTSW 17 42503746 missense probably benign 0.14
R0630:Ptchd4 UTSW 17 42377185 missense probably benign 0.17
R0662:Ptchd4 UTSW 17 42502576 missense probably damaging 1.00
R1004:Ptchd4 UTSW 17 42377602 missense probably benign 0.00
R1433:Ptchd4 UTSW 17 42503715 missense possibly damaging 0.75
R1451:Ptchd4 UTSW 17 42502918 missense probably damaging 0.99
R1522:Ptchd4 UTSW 17 42503542 missense probably damaging 1.00
R1901:Ptchd4 UTSW 17 42503616 missense probably benign 0.10
R1902:Ptchd4 UTSW 17 42503616 missense probably benign 0.10
R2135:Ptchd4 UTSW 17 42317074 missense probably benign 0.01
R3935:Ptchd4 UTSW 17 42503489 missense possibly damaging 0.80
R4552:Ptchd4 UTSW 17 42502455 missense probably benign 0.00
R4573:Ptchd4 UTSW 17 42502777 missense probably benign 0.26
R5100:Ptchd4 UTSW 17 42503676 missense possibly damaging 0.59
R5640:Ptchd4 UTSW 17 42503135 missense possibly damaging 0.73
R6213:Ptchd4 UTSW 17 42377360 missense probably benign 0.00
R6704:Ptchd4 UTSW 17 42317040 missense probably benign 0.00
R7011:Ptchd4 UTSW 17 42503868 missense probably benign 0.19
R7017:Ptchd4 UTSW 17 42502735 missense probably damaging 1.00
R7185:Ptchd4 UTSW 17 42503188 missense probably damaging 1.00
R8112:Ptchd4 UTSW 17 42503175 missense probably benign 0.25
R8153:Ptchd4 UTSW 17 42503896 missense probably benign 0.31
R8220:Ptchd4 UTSW 17 42502663 missense probably benign 0.00
X0062:Ptchd4 UTSW 17 42377464 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCTGTAAGATCCCTTCTGC -3'
(R):5'- TGCAGATCCTCTTGGACACTG -3'

Sequencing Primer
(F):5'- TTCTGCAGAATACCTGGACCG -3'
(R):5'- TCCAGTACTCCAGGGGTTCATAGAC -3'
Posted On2015-06-10