Incidental Mutation 'R4190:Ctse'
ID319900
Institutional Source Beutler Lab
Gene Symbol Ctse
Ensembl Gene ENSMUSG00000004552
Gene Namecathepsin E
SynonymsCatE, C920004C08Rik, CE, A430072O03Rik
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4190 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131638306-131675505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131662741 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 67 (V67D)
Ref Sequence ENSEMBL: ENSMUSP00000108030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073350] [ENSMUST00000112411]
Predicted Effect probably benign
Transcript: ENSMUST00000073350
AA Change: V67D

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000073072
Gene: ENSMUSG00000004552
AA Change: V67D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:A1_Propeptide 22 50 7e-14 PFAM
Pfam:Asp 78 395 2.1e-129 PFAM
Pfam:TAXi_N 79 236 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112411
AA Change: V67D

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108030
Gene: ENSMUSG00000004552
AA Change: V67D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:A1_Propeptide 22 50 2.7e-12 PFAM
Pfam:Asp 78 315 2e-99 PFAM
Pfam:TAXi_N 79 236 6.1e-14 PFAM
Pfam:Asp 310 362 6.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141061
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartate proteases and preproprotein that is proteolytically processed to generate a mature protein product. The encoded protein may be involved in antigen processing and the maturation of secretory proteins. Elevated expression of this gene has been observed in neurodegeneration. Homozygous knockout mice for this gene exhibit lysosomal storage disorder, impaired autophagy, mitochondrial abnormalities, dermatitis, and reduced weight gain in an obesity model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile, but develop skin lesions on the face, ears, neck and dorsal skin which are similar to those seen in human atopic dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Ctse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Ctse APN 1 131672535 missense probably benign 0.00
IGL02492:Ctse APN 1 131668234 missense probably damaging 1.00
R0057:Ctse UTSW 1 131663371 missense probably damaging 1.00
R0057:Ctse UTSW 1 131663371 missense probably damaging 1.00
R0690:Ctse UTSW 1 131674778 splice site probably benign
R2198:Ctse UTSW 1 131672447 nonsense probably null
R4668:Ctse UTSW 1 131662749 missense probably damaging 1.00
R4971:Ctse UTSW 1 131664392 missense probably damaging 1.00
R5070:Ctse UTSW 1 131668179 missense probably damaging 1.00
R5499:Ctse UTSW 1 131672513 nonsense probably null
R5705:Ctse UTSW 1 131664374 missense possibly damaging 0.82
R7207:Ctse UTSW 1 131664374 missense possibly damaging 0.82
R7828:Ctse UTSW 1 131662753 missense probably damaging 1.00
R8157:Ctse UTSW 1 131672511 missense probably damaging 1.00
R8237:Ctse UTSW 1 131662729 missense probably benign 0.01
R8270:Ctse UTSW 1 131668139 missense probably damaging 1.00
X0067:Ctse UTSW 1 131670772 missense probably damaging 1.00
Z1177:Ctse UTSW 1 131672444 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGTCAGGCTCTGAACAGGTATAG -3'
(R):5'- CTGGGTCATTTAGAAGCCTGC -3'

Sequencing Primer
(F):5'- CTCTGAACAGGTATAGAGGCAATG -3'
(R):5'- GGTCATTTAGAAGCCTGCTTTACAG -3'
Posted On2015-06-10