Incidental Mutation 'R4190:Fam69b'
ID319901
Institutional Source Beutler Lab
Gene Symbol Fam69b
Ensembl Gene ENSMUSG00000036186
Gene Namefamily with sequence similarity 69, member B
SynonymsB230317C12Rik, PIP49
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R4190 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26628457-26636497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26636181 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 376 (Y376H)
Ref Sequence ENSEMBL: ENSMUSP00000073860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074240] [ENSMUST00000174066]
Predicted Effect probably damaging
Transcript: ENSMUST00000074240
AA Change: Y376H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073860
Gene: ENSMUSG00000036186
AA Change: Y376H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PIP49_N 22 180 2.18e-90 SMART
Pfam:PIP49_C 197 399 6.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131841
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153849
Predicted Effect probably benign
Transcript: ENSMUST00000174066
SMART Domains Protein: ENSMUSP00000133799
Gene: ENSMUSG00000092356

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 64 88 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181621
Meta Mutation Damage Score 0.1885 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the FAM69 family of cysteine-rich type II transmembrane proteins. These proteins localize to the endoplasmic reticulum but their specific functions are unknown. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Fam69b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01927:Fam69b APN 2 26636115 missense probably benign 0.00
R0669:Fam69b UTSW 2 26634866 missense probably benign 0.00
R1912:Fam69b UTSW 2 26632704 missense probably damaging 1.00
R2258:Fam69b UTSW 2 26635150 missense probably damaging 0.99
R2760:Fam69b UTSW 2 26635825 missense probably benign 0.00
R3712:Fam69b UTSW 2 26632638 missense possibly damaging 0.72
R3953:Fam69b UTSW 2 26635567 missense probably benign 0.44
R3956:Fam69b UTSW 2 26635567 missense probably benign 0.44
R4213:Fam69b UTSW 2 26635948 missense probably benign 0.05
R5161:Fam69b UTSW 2 26636248 missense possibly damaging 0.92
R5618:Fam69b UTSW 2 26634875 missense probably damaging 0.99
R6198:Fam69b UTSW 2 26635698 missense probably damaging 0.96
R6769:Fam69b UTSW 2 26634863 missense probably benign 0.00
R6771:Fam69b UTSW 2 26634863 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTCAAGATGGCTGACCTG -3'
(R):5'- AACCTGTGAGCTGTAGTGCC -3'

Sequencing Primer
(F):5'- CCTGCAGCAGGTGGCAC -3'
(R):5'- AGCTGTAGTGCCTGGAGC -3'
Posted On2015-06-10