Incidental Mutation 'R4190:Nlgn1'
ID319904
Institutional Source Beutler Lab
Gene Symbol Nlgn1
Ensembl Gene ENSMUSG00000063887
Gene Nameneuroligin 1
SynonymsNL1, Nlg1, 6330415N05Rik
MMRRC Submission 041021-MU
Accession Numbers

Ncbi RefSeq: NM_138666.3; NM_001163387.1; MGI:2179435

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4190 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location25426215-26332460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25433898 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 758 (T758S)
Ref Sequence ENSEMBL: ENSMUSP00000142200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075054] [ENSMUST00000108308] [ENSMUST00000191835] [ENSMUST00000193603]
PDB Structure
Crystal structure of a synaptic adhesion complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000075054
AA Change: T758S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074565
Gene: ENSMUSG00000063887
AA Change: T758S

DomainStartEndE-ValueType
Pfam:COesterase 29 626 4.8e-199 PFAM
Pfam:Abhydrolase_3 196 302 2.2e-8 PFAM
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 720 731 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 816 827 N/A INTRINSIC
low complexity region 829 839 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108308
AA Change: T729S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103944
Gene: ENSMUSG00000063887
AA Change: T729S

DomainStartEndE-ValueType
Pfam:COesterase 29 597 2.5e-190 PFAM
Pfam:Abhydrolase_3 176 306 4.3e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191835
AA Change: T729S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142086
Gene: ENSMUSG00000063887
AA Change: T729S

DomainStartEndE-ValueType
Pfam:COesterase 29 597 2.5e-190 PFAM
Pfam:Abhydrolase_3 176 306 4.3e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193603
AA Change: T758S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142200
Gene: ENSMUSG00000063887
AA Change: T758S

DomainStartEndE-ValueType
Pfam:COesterase 29 626 1.2e-186 PFAM
Pfam:Abhydrolase_3 196 309 3.7e-8 PFAM
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 720 731 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 816 827 N/A INTRINSIC
low complexity region 829 839 N/A INTRINSIC
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
MGI Phenotype Strain: 3687638
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but display impaired NMDA receptor-mediated synaptic transmission onto CA1 pyramidal cells. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Nlgn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Nlgn1 APN 3 25436490 missense probably benign 0.02
IGL00543:Nlgn1 APN 3 25433781 missense probably damaging 1.00
IGL00960:Nlgn1 APN 3 25912697 missense probably damaging 1.00
IGL01533:Nlgn1 APN 3 25436363 missense possibly damaging 0.69
IGL02146:Nlgn1 APN 3 25912682 missense probably damaging 0.96
IGL02616:Nlgn1 APN 3 25434245 missense probably damaging 0.99
IGL03342:Nlgn1 APN 3 26133262 missense probably damaging 1.00
P0018:Nlgn1 UTSW 3 25436577 missense probably damaging 1.00
R0010:Nlgn1 UTSW 3 25435842 splice site probably benign
R0010:Nlgn1 UTSW 3 25435842 splice site probably benign
R0123:Nlgn1 UTSW 3 25435925 missense probably damaging 1.00
R0134:Nlgn1 UTSW 3 25435925 missense probably damaging 1.00
R0294:Nlgn1 UTSW 3 26133476 missense probably benign 0.23
R0798:Nlgn1 UTSW 3 25434246 missense probably benign 0.05
R1051:Nlgn1 UTSW 3 25912705 missense probably damaging 0.98
R1116:Nlgn1 UTSW 3 25433874 missense probably benign 0.00
R1289:Nlgn1 UTSW 3 25434236 missense possibly damaging 0.87
R1522:Nlgn1 UTSW 3 25435909 missense probably damaging 1.00
R1550:Nlgn1 UTSW 3 25912644 missense probably damaging 1.00
R1669:Nlgn1 UTSW 3 25436134 missense probably damaging 1.00
R1853:Nlgn1 UTSW 3 26133522 missense possibly damaging 0.80
R1856:Nlgn1 UTSW 3 25440037 nonsense probably null
R1935:Nlgn1 UTSW 3 26331790 utr 5 prime probably benign
R1936:Nlgn1 UTSW 3 26331790 utr 5 prime probably benign
R1952:Nlgn1 UTSW 3 25436300 missense probably damaging 1.00
R1953:Nlgn1 UTSW 3 25436300 missense probably damaging 1.00
R2004:Nlgn1 UTSW 3 25433870 missense probably benign 0.29
R2114:Nlgn1 UTSW 3 26133265 missense probably damaging 1.00
R2116:Nlgn1 UTSW 3 26133265 missense probably damaging 1.00
R2198:Nlgn1 UTSW 3 25433761 missense probably damaging 0.99
R2994:Nlgn1 UTSW 3 25435998 missense probably damaging 1.00
R3056:Nlgn1 UTSW 3 25433696 missense possibly damaging 0.53
R4196:Nlgn1 UTSW 3 25434392 missense probably damaging 1.00
R4613:Nlgn1 UTSW 3 25436022 missense probably benign 0.01
R4654:Nlgn1 UTSW 3 26133701 missense possibly damaging 0.51
R4757:Nlgn1 UTSW 3 25436343 missense possibly damaging 0.63
R4757:Nlgn1 UTSW 3 25436168 missense probably damaging 1.00
R4815:Nlgn1 UTSW 3 25436030 missense probably damaging 0.99
R4884:Nlgn1 UTSW 3 25912674 missense probably damaging 1.00
R4966:Nlgn1 UTSW 3 25920237 missense possibly damaging 0.65
R5119:Nlgn1 UTSW 3 25433794 missense probably damaging 0.99
R5842:Nlgn1 UTSW 3 26133743 unclassified probably null
R6218:Nlgn1 UTSW 3 25436093 missense probably damaging 1.00
R6397:Nlgn1 UTSW 3 25433663 missense possibly damaging 0.53
R6500:Nlgn1 UTSW 3 25433930 missense possibly damaging 0.84
R6822:Nlgn1 UTSW 3 26133647 missense probably benign 0.00
R6846:Nlgn1 UTSW 3 25436342 missense probably damaging 0.99
R7047:Nlgn1 UTSW 3 25436035 nonsense probably null
R7147:Nlgn1 UTSW 3 26133360 missense probably benign 0.02
R7754:Nlgn1 UTSW 3 25434303 missense probably damaging 1.00
R7886:Nlgn1 UTSW 3 25435907 missense probably damaging 1.00
R7969:Nlgn1 UTSW 3 25435907 missense probably damaging 1.00
Z1176:Nlgn1 UTSW 3 25436604 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCTGTCCTCCAGTAAATGTGTTG -3'
(R):5'- TCAGAGGGACTACTCCACAG -3'

Sequencing Primer
(F):5'- TGAATGTATGTAAGGGCTGAATCCC -3'
(R):5'- AGCTAAGTGTCACTATCGCAG -3'
Posted On2015-06-10