Incidental Mutation 'R4190:Ddx19b'
ID319917
Institutional Source Beutler Lab
Gene Symbol Ddx19b
Ensembl Gene ENSMUSG00000033658
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 19b
Synonyms
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4190 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111003188-111031751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 111011348 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 256 (L256Q)
Ref Sequence ENSEMBL: ENSMUSP00000066806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040241] [ENSMUST00000065784]
Predicted Effect probably damaging
Transcript: ENSMUST00000040241
AA Change: L241Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038551
Gene: ENSMUSG00000033658
AA Change: L241Q

DomainStartEndE-ValueType
Blast:DEXDc 5 44 1e-12 BLAST
low complexity region 45 55 N/A INTRINSIC
Blast:DEXDc 57 99 4e-11 BLAST
DEXDc 111 310 2.94e-42 SMART
HELICc 347 434 2.59e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065784
AA Change: L256Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066806
Gene: ENSMUSG00000033658
AA Change: L256Q

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
low complexity region 60 70 N/A INTRINSIC
Blast:DEXDc 72 114 5e-11 BLAST
DEXDc 126 325 2.94e-42 SMART
HELICc 362 449 2.59e-29 SMART
Meta Mutation Damage Score 0.8927 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which exhibits RNA-dependent ATPase and ATP-dependent RNA-unwinding activities. This protein is recruited to the cytoplasmic fibrils of the nuclear pore complex, where it participates in the export of mRNA from the nucleus. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Ddx19b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Ddx19b APN 8 111020988 missense probably damaging 1.00
IGL02089:Ddx19b APN 8 111008845 splice site probably benign
IGL02445:Ddx19b APN 8 111008824 missense probably damaging 1.00
IGL02756:Ddx19b APN 8 111011278 splice site probably benign
R0411:Ddx19b UTSW 8 111023964 critical splice donor site probably null
R0483:Ddx19b UTSW 8 111008678 missense probably benign 0.07
R1510:Ddx19b UTSW 8 111015653 missense probably damaging 1.00
R1797:Ddx19b UTSW 8 111012807 missense probably damaging 1.00
R1969:Ddx19b UTSW 8 111008258 missense probably benign 0.00
R1981:Ddx19b UTSW 8 111009343 missense possibly damaging 0.88
R1982:Ddx19b UTSW 8 111009343 missense possibly damaging 0.88
R3771:Ddx19b UTSW 8 111020981 missense probably benign 0.03
R4191:Ddx19b UTSW 8 111011348 missense probably damaging 1.00
R4193:Ddx19b UTSW 8 111011348 missense probably damaging 1.00
R5132:Ddx19b UTSW 8 111022408 missense probably benign
R5435:Ddx19b UTSW 8 111008826 missense possibly damaging 0.67
R8062:Ddx19b UTSW 8 111020979 missense probably benign 0.00
R8265:Ddx19b UTSW 8 111009192 missense probably damaging 1.00
Z1088:Ddx19b UTSW 8 111015575 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- ACAGCTGCTGTGCAAATGG -3'
(R):5'- GCCCACTAGATATTATGGTGGC -3'

Sequencing Primer
(F):5'- TGCTGTGCAAATGGCCCAC -3'
(R):5'- GCAGCTTCAGAATGCCTCC -3'
Posted On2015-06-10