Incidental Mutation 'R4190:Zfp202'
ID319918
Institutional Source Beutler Lab
Gene Symbol Zfp202
Ensembl Gene ENSMUSG00000025602
Gene Namezinc finger protein 202
SynonymsC130037E22Rik
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4190 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40192316-40213604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40211337 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 465 (V465A)
Ref Sequence ENSEMBL: ENSMUSP00000026693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026693] [ENSMUST00000168691] [ENSMUST00000168832]
Predicted Effect probably benign
Transcript: ENSMUST00000026693
AA Change: V465A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026693
Gene: ENSMUSG00000025602
AA Change: V465A

DomainStartEndE-ValueType
SCAN 42 154 1.19e-75 SMART
KRAB 237 297 1.7e-17 SMART
ZnF_C2H2 391 413 9.44e-2 SMART
ZnF_C2H2 419 441 6.42e-4 SMART
ZnF_C2H2 473 495 3.44e-4 SMART
ZnF_C2H2 501 523 1.47e-3 SMART
ZnF_C2H2 529 551 1.64e-1 SMART
ZnF_C2H2 557 579 3.11e-2 SMART
ZnF_C2H2 585 607 8.47e-4 SMART
ZnF_C2H2 613 635 3.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168691
SMART Domains Protein: ENSMUSP00000130163
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 132 1.03e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168832
SMART Domains Protein: ENSMUSP00000132131
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 154 1.19e-75 SMART
KRAB 237 277 5.32e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Other mutations in Zfp202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Zfp202 APN 9 40211043 missense probably benign 0.02
IGL01862:Zfp202 APN 9 40211828 missense probably benign 0.39
IGL03069:Zfp202 APN 9 40211399 missense probably damaging 1.00
R0028:Zfp202 UTSW 9 40211752 missense probably damaging 1.00
R0158:Zfp202 UTSW 9 40208916 nonsense probably null
R0278:Zfp202 UTSW 9 40208482 missense probably benign 0.15
R1132:Zfp202 UTSW 9 40211022 missense probably benign 0.00
R1404:Zfp202 UTSW 9 40211496 missense probably damaging 1.00
R1404:Zfp202 UTSW 9 40211496 missense probably damaging 1.00
R1764:Zfp202 UTSW 9 40210466 missense probably benign 0.00
R1928:Zfp202 UTSW 9 40209787 missense probably damaging 1.00
R2929:Zfp202 UTSW 9 40211688 missense possibly damaging 0.94
R3153:Zfp202 UTSW 9 40208438 missense probably benign 0.00
R3948:Zfp202 UTSW 9 40208425 missense probably benign 0.43
R4273:Zfp202 UTSW 9 40207494 nonsense probably null
R6181:Zfp202 UTSW 9 40207342 missense probably damaging 1.00
R6182:Zfp202 UTSW 9 40207342 missense probably damaging 1.00
R6816:Zfp202 UTSW 9 40211813 missense probably damaging 1.00
R6835:Zfp202 UTSW 9 40210235 intron probably null
R7382:Zfp202 UTSW 9 40211505 missense probably damaging 1.00
R7493:Zfp202 UTSW 9 40207344 missense possibly damaging 0.57
R7542:Zfp202 UTSW 9 40211147 missense probably benign 0.12
R7689:Zfp202 UTSW 9 40210533 missense probably benign 0.02
R7832:Zfp202 UTSW 9 40210462 missense possibly damaging 0.92
R8084:Zfp202 UTSW 9 40211242 missense probably benign 0.19
X0012:Zfp202 UTSW 9 40211184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGCACTTAAGAACTCACACAGG -3'
(R):5'- CTGCTCACTGAAGTTCTCGC -3'

Sequencing Primer
(F):5'- TTAAGAACTCACACAGGAGAAAAAC -3'
(R):5'- TAGGGCTTGCCTCCAACATG -3'
Posted On2015-06-10