Incidental Mutation 'R4190:Vmn2r84'
ID319927
Institutional Source Beutler Lab
Gene Symbol Vmn2r84
Ensembl Gene ENSMUSG00000070601
Gene Namevomeronasal 2, receptor 84
SynonymsEG625068
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4190 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location130385316-130394241 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 130391294 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 225 (L225*)
Ref Sequence ENSEMBL: ENSMUSP00000092079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094502]
Predicted Effect probably null
Transcript: ENSMUST00000094502
AA Change: L225*
SMART Domains Protein: ENSMUSP00000092079
Gene: ENSMUSG00000070601
AA Change: L225*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 77 448 1.3e-27 PFAM
Pfam:NCD3G 508 561 6.9e-21 PFAM
Pfam:7tm_3 594 830 4.6e-55 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Vmn2r84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Vmn2r84 APN 10 130391225 missense possibly damaging 0.65
IGL01590:Vmn2r84 APN 10 130386095 missense probably damaging 1.00
IGL01639:Vmn2r84 APN 10 130389272 nonsense probably null
IGL01843:Vmn2r84 APN 10 130386279 missense probably benign
IGL01911:Vmn2r84 APN 10 130386408 missense probably damaging 0.99
IGL01937:Vmn2r84 APN 10 130385886 missense probably damaging 1.00
IGL01977:Vmn2r84 APN 10 130394066 missense probably benign 0.11
IGL02177:Vmn2r84 APN 10 130392012 missense probably benign 0.00
IGL02291:Vmn2r84 APN 10 130390748 missense probably damaging 1.00
IGL02590:Vmn2r84 APN 10 130391487 splice site probably benign
IGL02727:Vmn2r84 APN 10 130394126 missense possibly damaging 0.95
IGL02900:Vmn2r84 APN 10 130387992 splice site probably benign
IGL03383:Vmn2r84 APN 10 130386687 missense probably damaging 1.00
PIT4378001:Vmn2r84 UTSW 10 130385915 missense probably damaging 1.00
R0076:Vmn2r84 UTSW 10 130394193 missense probably damaging 1.00
R0089:Vmn2r84 UTSW 10 130386719 splice site probably benign
R0153:Vmn2r84 UTSW 10 130392008 missense probably benign 0.06
R0611:Vmn2r84 UTSW 10 130386122 missense probably damaging 1.00
R0883:Vmn2r84 UTSW 10 130391115 missense probably damaging 0.99
R1237:Vmn2r84 UTSW 10 130387856 splice site probably null
R1295:Vmn2r84 UTSW 10 130389139 missense probably benign 0.12
R1401:Vmn2r84 UTSW 10 130391990 missense possibly damaging 0.89
R1521:Vmn2r84 UTSW 10 130389268 missense probably benign 0.10
R1590:Vmn2r84 UTSW 10 130391480 critical splice acceptor site probably null
R1710:Vmn2r84 UTSW 10 130391099 missense probably benign 0.02
R1891:Vmn2r84 UTSW 10 130386069 missense possibly damaging 0.78
R1956:Vmn2r84 UTSW 10 130390808 missense probably benign 0.01
R1957:Vmn2r84 UTSW 10 130390808 missense probably benign 0.01
R1962:Vmn2r84 UTSW 10 130390722 missense probably damaging 0.99
R1994:Vmn2r84 UTSW 10 130386009 missense probably damaging 1.00
R2124:Vmn2r84 UTSW 10 130391231 missense probably damaging 0.99
R2409:Vmn2r84 UTSW 10 130392071 missense probably damaging 0.99
R2474:Vmn2r84 UTSW 10 130386523 missense possibly damaging 0.50
R2851:Vmn2r84 UTSW 10 130394167 missense probably benign 0.05
R3508:Vmn2r84 UTSW 10 130390908 missense probably damaging 1.00
R3792:Vmn2r84 UTSW 10 130385800 makesense probably null
R4051:Vmn2r84 UTSW 10 130390898 missense probably damaging 1.00
R4061:Vmn2r84 UTSW 10 130386029 missense probably damaging 1.00
R4091:Vmn2r84 UTSW 10 130391369 missense probably damaging 1.00
R4520:Vmn2r84 UTSW 10 130386522 missense probably damaging 1.00
R4584:Vmn2r84 UTSW 10 130390713 missense probably benign 0.00
R4588:Vmn2r84 UTSW 10 130385940 missense probably damaging 0.98
R4655:Vmn2r84 UTSW 10 130394104 nonsense probably null
R4860:Vmn2r84 UTSW 10 130385843 missense probably damaging 0.99
R4860:Vmn2r84 UTSW 10 130385843 missense probably damaging 0.99
R5022:Vmn2r84 UTSW 10 130386548 missense probably damaging 1.00
R5146:Vmn2r84 UTSW 10 130386102 missense probably damaging 1.00
R5237:Vmn2r84 UTSW 10 130385994 missense probably damaging 0.99
R5695:Vmn2r84 UTSW 10 130389195 missense probably benign 0.12
R5793:Vmn2r84 UTSW 10 130385885 missense probably damaging 0.99
R6210:Vmn2r84 UTSW 10 130386245 missense probably damaging 1.00
R6286:Vmn2r84 UTSW 10 130390868 missense possibly damaging 0.65
R6580:Vmn2r84 UTSW 10 130389241 missense possibly damaging 0.93
R6607:Vmn2r84 UTSW 10 130390862 missense possibly damaging 0.87
R6818:Vmn2r84 UTSW 10 130386278 missense probably benign 0.09
R6956:Vmn2r84 UTSW 10 130389267 missense probably damaging 0.98
R6994:Vmn2r84 UTSW 10 130391007 missense possibly damaging 0.90
R7075:Vmn2r84 UTSW 10 130391072 missense probably damaging 0.99
R7225:Vmn2r84 UTSW 10 130386683 missense probably damaging 0.99
R7252:Vmn2r84 UTSW 10 130386410 missense probably damaging 1.00
R7263:Vmn2r84 UTSW 10 130389208 missense probably damaging 1.00
R7297:Vmn2r84 UTSW 10 130391250 missense probably benign 0.19
R7439:Vmn2r84 UTSW 10 130392113 missense possibly damaging 0.90
R7441:Vmn2r84 UTSW 10 130392113 missense possibly damaging 0.90
R7857:Vmn2r84 UTSW 10 130390869 missense probably benign 0.00
R8263:Vmn2r84 UTSW 10 130391168 missense probably damaging 1.00
R8555:Vmn2r84 UTSW 10 130394231 missense probably benign 0.28
R8766:Vmn2r84 UTSW 10 130386372 missense probably damaging 0.98
R8821:Vmn2r84 UTSW 10 130391099 missense probably benign 0.02
R8831:Vmn2r84 UTSW 10 130391099 missense probably benign 0.02
Z1177:Vmn2r84 UTSW 10 130391902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTGTGAGGTTGTGATCCAG -3'
(R):5'- GACCATTTAATCCTAAACTGAGTGACC -3'

Sequencing Primer
(F):5'- GAGGTTGTGATCCAGATCCTCC -3'
(R):5'- AACTGAGTGACCATGACCATTTTCC -3'
Posted On2015-06-10