Incidental Mutation 'R4190:Vmn2r87'
ID319928
Institutional Source Beutler Lab
Gene Symbol Vmn2r87
Ensembl Gene ENSMUSG00000091511
Gene Namevomeronasal 2, receptor 87
SynonymsEG625131
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R4190 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location130471332-130497379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130472687 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 561 (Y561H)
Ref Sequence ENSEMBL: ENSMUSP00000129215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164227]
Predicted Effect probably damaging
Transcript: ENSMUST00000164227
AA Change: Y561H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129215
Gene: ENSMUSG00000091511
AA Change: Y561H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 422 1.8e-27 PFAM
Pfam:NCD3G 508 562 1.8e-19 PFAM
Pfam:7tm_3 595 829 8.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218030
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Vmn2r87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r87 APN 10 130497378 start codon destroyed probably null 1.00
IGL01295:Vmn2r87 APN 10 130472009 missense probably damaging 1.00
IGL01411:Vmn2r87 APN 10 130472560 missense probably benign 0.03
IGL01680:Vmn2r87 APN 10 130479717 nonsense probably null
IGL01822:Vmn2r87 APN 10 130472122 missense probably damaging 1.00
IGL01835:Vmn2r87 APN 10 130479109 missense probably damaging 1.00
IGL01965:Vmn2r87 APN 10 130479055 missense possibly damaging 0.49
IGL02562:Vmn2r87 APN 10 130478644 missense probably damaging 1.00
IGL02665:Vmn2r87 APN 10 130497180 missense probably benign 0.16
IGL03202:Vmn2r87 APN 10 130497222 missense probably benign
FR4304:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4340:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4342:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4589:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
LCD18:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
R0344:Vmn2r87 UTSW 10 130479937 missense probably damaging 1.00
R0374:Vmn2r87 UTSW 10 130471979 missense probably damaging 1.00
R0384:Vmn2r87 UTSW 10 130471843 missense probably benign
R1144:Vmn2r87 UTSW 10 130476229 splice site probably benign
R1172:Vmn2r87 UTSW 10 130477584 missense probably benign 0.03
R1860:Vmn2r87 UTSW 10 130479886 missense probably benign 0.00
R1866:Vmn2r87 UTSW 10 130472572 missense possibly damaging 0.88
R1897:Vmn2r87 UTSW 10 130471960 missense probably damaging 1.00
R2360:Vmn2r87 UTSW 10 130479762 missense probably damaging 0.99
R2909:Vmn2r87 UTSW 10 130478996 missense probably damaging 0.99
R3874:Vmn2r87 UTSW 10 130479987 missense possibly damaging 0.62
R4113:Vmn2r87 UTSW 10 130479822 missense probably benign
R4197:Vmn2r87 UTSW 10 130479910 missense possibly damaging 0.55
R4201:Vmn2r87 UTSW 10 130472579 missense probably benign 0.03
R4202:Vmn2r87 UTSW 10 130472579 missense probably benign 0.03
R4368:Vmn2r87 UTSW 10 130479807 missense probably benign 0.44
R4485:Vmn2r87 UTSW 10 130479809 nonsense probably null
R4537:Vmn2r87 UTSW 10 130472185 missense probably benign 0.12
R4590:Vmn2r87 UTSW 10 130479145 missense possibly damaging 0.69
R4752:Vmn2r87 UTSW 10 130478467 nonsense probably null
R4873:Vmn2r87 UTSW 10 130472498 missense probably damaging 1.00
R4875:Vmn2r87 UTSW 10 130472498 missense probably damaging 1.00
R4923:Vmn2r87 UTSW 10 130478566 missense probably damaging 0.99
R4970:Vmn2r87 UTSW 10 130478553 missense probably damaging 1.00
R5049:Vmn2r87 UTSW 10 130472429 missense probably damaging 0.96
R5112:Vmn2r87 UTSW 10 130478553 missense probably damaging 1.00
R5187:Vmn2r87 UTSW 10 130497339 missense probably null 0.99
R5618:Vmn2r87 UTSW 10 130479948 missense probably damaging 1.00
R6057:Vmn2r87 UTSW 10 130472357 missense probably benign 0.02
R6220:Vmn2r87 UTSW 10 130479938 missense probably benign 0.01
R6287:Vmn2r87 UTSW 10 130478422 critical splice donor site probably null
R6383:Vmn2r87 UTSW 10 130479000 missense probably damaging 1.00
R6576:Vmn2r87 UTSW 10 130478785 missense probably benign 0.05
R6742:Vmn2r87 UTSW 10 130472527 missense probably damaging 1.00
R7086:Vmn2r87 UTSW 10 130497309 missense probably benign 0.00
R7162:Vmn2r87 UTSW 10 130477547 missense probably benign 0.08
R7419:Vmn2r87 UTSW 10 130472123 missense probably damaging 1.00
R7425:Vmn2r87 UTSW 10 130478892 missense probably damaging 1.00
R7443:Vmn2r87 UTSW 10 130472719 missense probably damaging 1.00
R7571:Vmn2r87 UTSW 10 130479071 missense probably damaging 0.99
R7663:Vmn2r87 UTSW 10 130472185 missense probably damaging 0.97
R7716:Vmn2r87 UTSW 10 130472149 missense probably benign 0.09
R7793:Vmn2r87 UTSW 10 130477544 missense probably benign 0.05
R7806:Vmn2r87 UTSW 10 130479810 missense probably benign
R7841:Vmn2r87 UTSW 10 130497226 missense probably benign 0.31
Z1088:Vmn2r87 UTSW 10 130472314 missense probably damaging 0.98
Z1176:Vmn2r87 UTSW 10 130471844 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCAGTTATTGGCCTTCACAATG -3'
(R):5'- CTGTTCCCTCACAATGCAGAG -3'

Sequencing Primer
(F):5'- ATTGGCCTTCACAATGGGAGTATCC -3'
(R):5'- TCCCTCACAATGCAGAGGTTAATAG -3'
Posted On2015-06-10