Incidental Mutation 'R4190:Ankrd13b'
ID319929
Institutional Source Beutler Lab
Gene Symbol Ankrd13b
Ensembl Gene ENSMUSG00000037907
Gene Nameankyrin repeat domain 13b
Synonyms
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.261) question?
Stock #R4190 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location77470485-77489678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77476375 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 21 (A21V)
Ref Sequence ENSEMBL: ENSMUSP00000119633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037593] [ENSMUST00000092892] [ENSMUST00000145934]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037593
AA Change: A236V

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073584
Gene: ENSMUSG00000037907
AA Change: A236V

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 491 5.5e-111 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 552 580 N/A INTRINSIC
UIM 585 604 3.15e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000092892
AA Change: A236V

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090568
Gene: ENSMUSG00000037907
AA Change: A236V

DomainStartEndE-ValueType
ANK 13 43 3.16e2 SMART
ANK 47 76 2.85e-5 SMART
ANK 80 109 1.17e2 SMART
Pfam:GPCR_chapero_1 163 490 3.2e-110 PFAM
UIM 503 522 1.81e-1 SMART
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127291
SMART Domains Protein: ENSMUSP00000118247
Gene: ENSMUSG00000037907

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 1 120 9.7e-31 PFAM
low complexity region 121 133 N/A INTRINSIC
low complexity region 184 200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143872
Predicted Effect probably damaging
Transcript: ENSMUST00000145934
AA Change: A21V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119633
Gene: ENSMUSG00000037907
AA Change: A21V

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 2 276 9.7e-90 PFAM
UIM 288 307 1.81e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Ankrd13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Ankrd13b APN 11 77472752 missense probably damaging 1.00
IGL01396:Ankrd13b APN 11 77472372 unclassified probably null
IGL02731:Ankrd13b APN 11 77476219 missense probably damaging 0.99
R0310:Ankrd13b UTSW 11 77472745 missense possibly damaging 0.71
R0496:Ankrd13b UTSW 11 77473041 missense probably damaging 1.00
R0511:Ankrd13b UTSW 11 77473288 missense possibly damaging 0.89
R0831:Ankrd13b UTSW 11 77472759 missense probably damaging 0.99
R1156:Ankrd13b UTSW 11 77472861 missense probably damaging 1.00
R1237:Ankrd13b UTSW 11 77474574 missense probably damaging 1.00
R2259:Ankrd13b UTSW 11 77476342 missense probably damaging 1.00
R3110:Ankrd13b UTSW 11 77477505 missense possibly damaging 0.67
R3112:Ankrd13b UTSW 11 77477505 missense possibly damaging 0.67
R4471:Ankrd13b UTSW 11 77476214 missense probably damaging 1.00
R4599:Ankrd13b UTSW 11 77471668 missense probably benign
R5253:Ankrd13b UTSW 11 77473235 intron probably benign
R5677:Ankrd13b UTSW 11 77477544 missense probably damaging 0.99
R7073:Ankrd13b UTSW 11 77472509 missense probably benign 0.39
R7388:Ankrd13b UTSW 11 77472757 missense probably benign 0.02
R7417:Ankrd13b UTSW 11 77476194 missense probably damaging 0.97
R7592:Ankrd13b UTSW 11 77476501 missense probably benign 0.45
R7596:Ankrd13b UTSW 11 77472314 missense probably benign 0.18
R7643:Ankrd13b UTSW 11 77473085 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGATTCTGCAAACGGCCTTC -3'
(R):5'- TCAGTGAGGCAGTAAGTCTGG -3'

Sequencing Primer
(F):5'- ATCAGGAGTGTGCGCAC -3'
(R):5'- CAGTAAGTCTGGCAGGGTG -3'
Posted On2015-06-10