Incidental Mutation 'R4190:Nr4a1'
ID319932
Institutional Source Beutler Lab
Gene Symbol Nr4a1
Ensembl Gene ENSMUSG00000023034
Gene Namenuclear receptor subfamily 4, group A, member 1
SynonymsTR3, Hbr1, Hmr, Gfrp, Hbr-1, NP10, GFRP1, NGFI-B, TIS1, Nur77, N10
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4190 (G1)
Quality Score140
Status Validated
Chromosome15
Chromosomal Location101254269-101274795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101274112 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 556 (S556P)
Ref Sequence ENSEMBL: ENSMUSP00000155225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023779] [ENSMUST00000228985] [ENSMUST00000230814]
Predicted Effect probably damaging
Transcript: ENSMUST00000023779
AA Change: S556P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023779
Gene: ENSMUSG00000023034
AA Change: S556P

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
low complexity region 77 102 N/A INTRINSIC
low complexity region 183 204 N/A INTRINSIC
ZnF_C4 267 338 1.93e-37 SMART
HOLI 411 569 3.77e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228985
AA Change: S556P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000230814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231153
Meta Mutation Damage Score 0.8394 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. Expression is induced by phytohemagglutinin in human lymphocytes and by serum stimulation of arrested fibroblasts. The encoded protein acts as a nuclear transcription factor. Translocation of the protein from the nucleus to mitochondria induces apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile, and display a normal HPA axis function, as well as normal thymic and peripheral T cell deletion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Nr4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Nr4a1 APN 15 101270899 missense probably damaging 1.00
IGL00966:Nr4a1 APN 15 101272788 missense probably damaging 1.00
IGL01326:Nr4a1 APN 15 101274059 missense probably damaging 1.00
R0539:Nr4a1 UTSW 15 101270884 missense probably damaging 1.00
R1853:Nr4a1 UTSW 15 101271764 missense probably benign 0.00
R1854:Nr4a1 UTSW 15 101271764 missense probably benign 0.00
R1909:Nr4a1 UTSW 15 101274227 missense probably damaging 1.00
R2073:Nr4a1 UTSW 15 101274067 missense probably damaging 0.96
R2392:Nr4a1 UTSW 15 101274194 missense possibly damaging 0.70
R2402:Nr4a1 UTSW 15 101271737 missense probably damaging 0.98
R3001:Nr4a1 UTSW 15 101270972 splice site probably null
R3002:Nr4a1 UTSW 15 101270972 splice site probably null
R5218:Nr4a1 UTSW 15 101272153 missense probably benign 0.02
R6363:Nr4a1 UTSW 15 101274115 missense probably damaging 1.00
R7559:Nr4a1 UTSW 15 101270899 missense probably damaging 1.00
R7910:Nr4a1 UTSW 15 101271760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATTGACCAGTCTGGACAGTG -3'
(R):5'- TAGGCTTAAAGGCACATGGG -3'

Sequencing Primer
(F):5'- AGTCTGGACAGTGGGCTC -3'
(R):5'- CAGAAGAGCACGCACGTGTG -3'
Posted On2015-06-10