Incidental Mutation 'R4190:Prodh'
ID319933
Institutional Source Beutler Lab
Gene Symbol Prodh
Ensembl Gene ENSMUSG00000003526
Gene Nameproline dehydrogenase
SynonymsPro1, Ym24d07, Pro-1
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4190 (G1)
Quality Score212
Status Validated
Chromosome16
Chromosomal Location18060357-18090203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18073640 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 480 (V480I)
Ref Sequence ENSEMBL: ENSMUSP00000003620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003620] [ENSMUST00000066027] [ENSMUST00000076757] [ENSMUST00000136776] [ENSMUST00000139861] [ENSMUST00000143343] [ENSMUST00000151266] [ENSMUST00000153123] [ENSMUST00000155387] [ENSMUST00000232554]
Predicted Effect probably benign
Transcript: ENSMUST00000003620
AA Change: V480I

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000003620
Gene: ENSMUSG00000003526
AA Change: V480I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
Pfam:Pro_dh 119 578 7.7e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066027
SMART Domains Protein: ENSMUSP00000067682
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 1 198 4e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076757
SMART Domains Protein: ENSMUSP00000076044
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 2 167 1.1e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123969
Predicted Effect unknown
Transcript: ENSMUST00000126087
AA Change: V150I
SMART Domains Protein: ENSMUSP00000121736
Gene: ENSMUSG00000003526
AA Change: V150I

DomainStartEndE-ValueType
Pfam:Pro_dh 25 244 2.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136776
AA Change: V378I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000117597
Gene: ENSMUSG00000003526
AA Change: V378I

DomainStartEndE-ValueType
low complexity region 118 129 N/A INTRINSIC
Pfam:Pro_dh 159 479 1.8e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139861
SMART Domains Protein: ENSMUSP00000123223
Gene: ENSMUSG00000003526

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 41 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141635
Predicted Effect probably benign
Transcript: ENSMUST00000143343
SMART Domains Protein: ENSMUSP00000123029
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 2 167 1.1e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148514
Predicted Effect probably benign
Transcript: ENSMUST00000151266
SMART Domains Protein: ENSMUSP00000122572
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 1 195 3.1e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153123
SMART Domains Protein: ENSMUSP00000118954
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 3 163 9.6e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155387
SMART Domains Protein: ENSMUSP00000123053
Gene: ENSMUSG00000003531

DomainStartEndE-ValueType
Pfam:DGCR6 2 41 1.6e-10 PFAM
Pfam:DGCR6 59 230 9.3e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232384
Predicted Effect probably benign
Transcript: ENSMUST00000232554
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
MGI Phenotype PHENOTYPE: Homozygotes for a spontaneous null mutation exhibit a slight reduction in male body weight, hyperprolinemia, increased startle reflex, and regionally altered brain levels of proline, glutamate, gamma-aminobutyric acid, and aspartate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Prodh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Prodh APN 16 18076344 missense probably damaging 0.99
IGL02063:Prodh APN 16 18079185 critical splice donor site probably null
IGL02525:Prodh APN 16 18072468 nonsense probably null
R0147:Prodh UTSW 16 18077813 missense probably damaging 1.00
R0148:Prodh UTSW 16 18077813 missense probably damaging 1.00
R1643:Prodh UTSW 16 18081069 missense probably benign 0.23
R1913:Prodh UTSW 16 18081027 missense probably damaging 1.00
R4191:Prodh UTSW 16 18073640 missense probably benign 0.27
R4193:Prodh UTSW 16 18073640 missense probably benign 0.27
R4204:Prodh UTSW 16 18072318 missense probably damaging 1.00
R5074:Prodh UTSW 16 18077789 critical splice donor site probably null
R6194:Prodh UTSW 16 18072517 missense probably benign 0.16
R6274:Prodh UTSW 16 18081058 missense possibly damaging 0.91
R6376:Prodh UTSW 16 18079985 missense probably benign
R6744:Prodh UTSW 16 18079200 missense probably benign 0.43
Z1177:Prodh UTSW 16 18089027 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGTCCACTGATGAAATCCCG -3'
(R):5'- ATGACAGGCAGGAACGGTTC -3'

Sequencing Primer
(F):5'- CAGTGCTGGGTTACAAGTCCTAC -3'
(R):5'- TTCTCTGCAGAGCCAACA -3'
Posted On2015-06-10