Incidental Mutation 'R4190:Fam234a'
ID319936
Institutional Source Beutler Lab
Gene Symbol Fam234a
Ensembl Gene ENSMUSG00000024187
Gene Namefamily with sequence similarity 234, member A
SynonymsItfg3
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R4190 (G1)
Quality Score92
Status Validated
Chromosome17
Chromosomal Location26211822-26244223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26213860 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 467 (L467Q)
Ref Sequence ENSEMBL: ENSMUSP00000113418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025020] [ENSMUST00000114988] [ENSMUST00000118487] [ENSMUST00000122058] [ENSMUST00000151293]
Predicted Effect probably benign
Transcript: ENSMUST00000025020
SMART Domains Protein: ENSMUSP00000025020
Gene: ENSMUSG00000024186

DomainStartEndE-ValueType
DEP 34 109 7.78e-17 SMART
G_gamma 220 284 1.38e-19 SMART
GGL 223 284 1.1e-26 SMART
RGS 303 418 6.23e-47 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114988
AA Change: L467Q

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110639
Gene: ENSMUSG00000024187
AA Change: L467Q

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118487
AA Change: L467Q

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113418
Gene: ENSMUSG00000024187
AA Change: L467Q

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 415 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122058
SMART Domains Protein: ENSMUSP00000113885
Gene: ENSMUSG00000024186

DomainStartEndE-ValueType
DEP 32 107 7.78e-17 SMART
G_gamma 218 282 1.38e-19 SMART
GGL 221 282 1.1e-26 SMART
RGS 301 416 6.23e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139639
Predicted Effect unknown
Transcript: ENSMUST00000141240
AA Change: L103Q
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147220
Predicted Effect probably benign
Transcript: ENSMUST00000151293
SMART Domains Protein: ENSMUSP00000117020
Gene: ENSMUSG00000024187

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155072
Meta Mutation Damage Score 0.7993 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Fam234a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Fam234a APN 17 26213526 missense probably damaging 1.00
IGL02635:Fam234a APN 17 26214453 missense possibly damaging 0.63
R0269:Fam234a UTSW 17 26216617 missense probably benign
R0617:Fam234a UTSW 17 26216617 missense probably benign
R1687:Fam234a UTSW 17 26215308 missense probably damaging 1.00
R1971:Fam234a UTSW 17 26216655 unclassified probably null
R2016:Fam234a UTSW 17 26218316 missense probably benign 0.07
R3826:Fam234a UTSW 17 26218189 missense probably benign
R3827:Fam234a UTSW 17 26218189 missense probably benign
R3829:Fam234a UTSW 17 26218189 missense probably benign
R4133:Fam234a UTSW 17 26213558 missense probably damaging 0.99
R4193:Fam234a UTSW 17 26213860 missense probably damaging 0.98
R4858:Fam234a UTSW 17 26216617 missense probably benign
R4885:Fam234a UTSW 17 26213585 missense probably benign 0.00
R5117:Fam234a UTSW 17 26213538 missense probably benign 0.18
R5719:Fam234a UTSW 17 26214653 missense possibly damaging 0.52
R5735:Fam234a UTSW 17 26213705 missense probably damaging 1.00
R6271:Fam234a UTSW 17 26218237 missense probably benign 0.19
R6341:Fam234a UTSW 17 26213693 missense probably damaging 1.00
R6365:Fam234a UTSW 17 26220455 nonsense probably null
R6621:Fam234a UTSW 17 26213881 missense probably damaging 1.00
R7393:Fam234a UTSW 17 26216624 missense probably benign 0.01
R7801:Fam234a UTSW 17 26218198 missense probably benign 0.00
RF020:Fam234a UTSW 17 26218751 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- TTTGGTGACAGAGACCAGGC -3'
(R):5'- AGCTTCTGAAAGTAGCCCG -3'

Sequencing Primer
(F):5'- AGGCACATCTGAGCTTGCTG -3'
(R):5'- CTTCTGAAAGTAGCCCGAGAGCTG -3'
Posted On2015-06-10