Incidental Mutation 'R4190:Ttbk1'
ID319938
Institutional Source Beutler Lab
Gene Symbol Ttbk1
Ensembl Gene ENSMUSG00000015599
Gene Nametau tubulin kinase 1
Synonyms
MMRRC Submission 041021-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R4190 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46442448-46487675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46479247 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 91 (C91S)
Ref Sequence ENSEMBL: ENSMUSP00000044580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047034] [ENSMUST00000223818] [ENSMUST00000225808]
Predicted Effect probably damaging
Transcript: ENSMUST00000047034
AA Change: C91S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599
AA Change: C91S

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Predicted Effect probably benign
Transcript: ENSMUST00000223818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224870
Predicted Effect probably damaging
Transcript: ENSMUST00000225808
AA Change: C91S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.9286 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene belongs to the casein kinase 1 superfamily. The encoded protein is a neuron-specific, serine/threonine and tyrosine kinase, which regulates phosphorylation of tau, a protein that associates with microtubule assemblies and stabilizes them. Genetic variants in this gene are associated with Alzheimer's disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 T C 12: 84,043,174 probably benign Het
Adgre1 A G 17: 57,402,811 Y156C unknown Het
Ankrd13b G A 11: 77,476,375 A21V probably damaging Het
Atf7ip T C 6: 136,587,501 V914A probably damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Calcr T A 6: 3,717,106 D118V possibly damaging Het
Cdc42bpg T C 19: 6,321,681 V1330A probably damaging Het
Cfap54 T C 10: 92,885,023 E2567G unknown Het
Ctse T A 1: 131,662,741 V67D probably benign Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Fahd2a C T 2: 127,438,566 V156I probably benign Het
Fam185a T A 5: 21,425,124 probably benign Het
Fam234a A T 17: 26,213,860 L467Q probably damaging Het
Fam69b T C 2: 26,636,181 Y376H probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Heatr3 T C 8: 88,138,260 probably benign Het
Herc2 T C 7: 56,122,448 V1125A probably benign Het
Itga11 T A 9: 62,732,109 C129S probably damaging Het
Lama2 A G 10: 27,266,664 L606P probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Mtmr10 G T 7: 64,314,186 W223L probably benign Het
Nlgn1 T A 3: 25,433,898 T758S probably benign Het
Nr4a1 T C 15: 101,274,112 S556P probably damaging Het
Olfr1261 C A 2: 89,993,574 Y60* probably null Het
Olfr488 T C 7: 108,256,123 D5G probably benign Het
Olfr770 T C 10: 129,132,967 N267S possibly damaging Het
Olfr820 A T 10: 130,017,978 I206F probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Plscr5 T C 9: 92,198,598 S46P probably benign Het
Ppp2r3d T C 9: 124,424,123 probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Sorcs3 T C 19: 48,749,373 V743A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stab2 G T 10: 86,878,944 N119K probably damaging Het
Telo2 T C 17: 25,102,013 T743A probably benign Het
Trav6-1 A G 14: 52,638,519 N2S probably benign Het
Trmt44 C A 5: 35,574,970 V26L possibly damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn2r84 A T 10: 130,391,294 L225* probably null Het
Vmn2r87 A G 10: 130,472,687 Y561H probably damaging Het
Yars T A 4: 129,200,027 C60* probably null Het
Zfp202 T C 9: 40,211,337 V465A probably benign Het
Other mutations in Ttbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Ttbk1 APN 17 46447063 missense probably damaging 1.00
IGL02469:Ttbk1 APN 17 46470630 missense possibly damaging 0.77
IGL02826:Ttbk1 APN 17 46470660 missense probably benign
IGL02874:Ttbk1 APN 17 46470225 missense probably benign 0.10
IGL02948:Ttbk1 APN 17 46446330 missense probably benign 0.44
IGL03037:Ttbk1 APN 17 46446330 missense probably benign 0.44
R0165:Ttbk1 UTSW 17 46478938 missense possibly damaging 0.70
R1186:Ttbk1 UTSW 17 46467131 missense probably damaging 1.00
R1228:Ttbk1 UTSW 17 46476712 critical splice donor site probably null
R1423:Ttbk1 UTSW 17 46446154 splice site probably benign
R1477:Ttbk1 UTSW 17 46476799 missense probably benign 0.05
R1960:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R1961:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R4043:Ttbk1 UTSW 17 46446762 missense probably benign 0.21
R4192:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4193:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4660:Ttbk1 UTSW 17 46477788 nonsense probably null
R5383:Ttbk1 UTSW 17 46467416 missense probably damaging 1.00
R5385:Ttbk1 UTSW 17 46447632 missense probably benign 0.00
R5715:Ttbk1 UTSW 17 46479207 missense probably damaging 0.99
R6218:Ttbk1 UTSW 17 46470807 missense possibly damaging 0.47
R6263:Ttbk1 UTSW 17 46467262 missense probably damaging 1.00
R6471:Ttbk1 UTSW 17 46467277 missense probably benign
R6537:Ttbk1 UTSW 17 46470310 missense probably damaging 0.98
R6552:Ttbk1 UTSW 17 46478962 missense probably benign 0.14
R7564:Ttbk1 UTSW 17 46476931 missense possibly damaging 0.66
R7853:Ttbk1 UTSW 17 46447343 missense probably benign 0.00
R7871:Ttbk1 UTSW 17 46446238 missense probably benign
R7873:Ttbk1 UTSW 17 46446568 missense probably damaging 1.00
R7908:Ttbk1 UTSW 17 46478938 missense probably damaging 1.00
R8210:Ttbk1 UTSW 17 46480161 missense possibly damaging 0.95
R8236:Ttbk1 UTSW 17 46470729 missense probably damaging 1.00
R8754:Ttbk1 UTSW 17 46445201 nonsense probably null
R8829:Ttbk1 UTSW 17 46446895 missense probably damaging 1.00
R8870:Ttbk1 UTSW 17 46470735 missense probably damaging 1.00
X0066:Ttbk1 UTSW 17 46446856 missense possibly damaging 0.74
Z1088:Ttbk1 UTSW 17 46446325 missense probably benign 0.35
Z1176:Ttbk1 UTSW 17 46460911 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATTCACCACCCAGCCTTG -3'
(R):5'- GCTGGGTGTAGTATACATACACA -3'

Sequencing Primer
(F):5'- CACCCAGCCTTGCCCCC -3'
(R):5'- TACAGAGATACAGTCACAGAGAGCTC -3'
Posted On2015-06-10