Incidental Mutation 'R4224:Fer1l4'
ID 319952
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Name fer-1 like family member 4
Synonyms 9130402C12Rik
MMRRC Submission 041044-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4224 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 155861059-155894867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 155862309 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 1788 (V1788G)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006035] [ENSMUST00000088650] [ENSMUST00000109611]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006035
SMART Domains Protein: ENSMUSP00000006035
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:ERGIC_N 6 101 2.2e-38 PFAM
Pfam:COPIIcoated_ERV 145 363 6.2e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088650
SMART Domains Protein: ENSMUSP00000086025
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:ERGIC_N 7 97 9e-35 PFAM
Pfam:COPIIcoated_ERV 145 374 7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109611
AA Change: V1788G

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: V1788G

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149381
Predicted Effect probably benign
Transcript: ENSMUST00000142859
SMART Domains Protein: ENSMUSP00000115912
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 74 246 1.9e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155370
SMART Domains Protein: ENSMUSP00000119051
Gene: ENSMUSG00000005881

DomainStartEndE-ValueType
Pfam:COPIIcoated_ERV 21 235 1e-95 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182O14Rik T C 15: 40,005,672 (GRCm39) probably null Het
Abl2 A G 1: 156,461,417 (GRCm39) T440A probably damaging Het
Acat2 T C 17: 13,181,772 (GRCm39) probably benign Het
Acsbg1 C T 9: 54,523,325 (GRCm39) R434H possibly damaging Het
Aif1l A T 2: 31,852,251 (GRCm39) S40C probably damaging Het
Atosa T A 9: 74,916,008 (GRCm39) N209K probably damaging Het
Atp6v1a C A 16: 43,922,174 (GRCm39) A355S probably damaging Het
Corin T C 5: 72,500,451 (GRCm39) E391G probably damaging Het
Dnah11 T G 12: 118,094,627 (GRCm39) S814R probably benign Het
Gm7964 T G 7: 83,406,030 (GRCm39) N281K probably damaging Het
Grin1 T C 2: 25,187,332 (GRCm39) probably benign Het
Ica1 T C 6: 8,659,960 (GRCm39) K112R probably benign Het
Itpr3 T C 17: 27,326,232 (GRCm39) V1334A probably damaging Het
Khdc3 C G 9: 73,010,153 (GRCm39) H70D possibly damaging Het
Lama3 T C 18: 12,583,460 (GRCm39) C683R probably damaging Het
Mettl21a G T 1: 64,647,115 (GRCm39) Y147* probably null Het
Mr1 A T 1: 155,006,465 (GRCm39) I294N possibly damaging Het
Or52z12 A G 7: 103,233,966 (GRCm39) T246A probably damaging Het
Or7e170 T A 9: 19,794,896 (GRCm39) Y235F probably benign Het
Pals1 A G 12: 78,876,492 (GRCm39) K479E probably damaging Het
Pcdhgb7 T A 18: 37,886,856 (GRCm39) D675E probably benign Het
Polr1has T C 17: 37,269,617 (GRCm39) probably benign Het
Ptbp1 T C 10: 79,695,047 (GRCm39) I125T probably benign Het
Rnf213 C T 11: 119,327,649 (GRCm39) R1879* probably null Het
Slc8a1 A G 17: 81,956,781 (GRCm39) F86L probably damaging Het
Spdya G A 17: 71,869,519 (GRCm39) V105I probably benign Het
Sspo G T 6: 48,428,091 (GRCm39) V313L possibly damaging Het
Stard9 A G 2: 120,495,472 (GRCm39) T116A possibly damaging Het
Tnnt1 T C 7: 4,513,006 (GRCm39) H92R probably damaging Het
Trim37 T A 11: 87,107,289 (GRCm39) C907S probably damaging Het
Trim43b T A 9: 88,972,692 (GRCm39) Q154L probably benign Het
Tssk3 T C 4: 129,384,392 (GRCm39) D3G probably benign Het
Ubash3a T C 17: 31,456,902 (GRCm39) Y521H probably damaging Het
Vmn1r73 T C 7: 11,490,506 (GRCm39) I108T probably damaging Het
Vmn2r14 A G 5: 109,364,149 (GRCm39) M589T probably benign Het
Vmn2r60 A T 7: 41,765,952 (GRCm39) T20S probably benign Het
Vps13b A G 15: 35,876,565 (GRCm39) T2799A probably damaging Het
Zcchc18 A T X: 135,895,415 (GRCm39) N10I probably damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 155,861,840 (GRCm39) nonsense probably null
IGL01025:Fer1l4 APN 2 155,894,105 (GRCm39) missense probably benign 0.41
IGL01103:Fer1l4 APN 2 155,886,361 (GRCm39) critical splice donor site probably null
IGL01322:Fer1l4 APN 2 155,862,259 (GRCm39) splice site probably null
IGL01391:Fer1l4 APN 2 155,878,376 (GRCm39) missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 155,890,371 (GRCm39) missense probably benign
IGL02267:Fer1l4 APN 2 155,873,172 (GRCm39) missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 155,861,458 (GRCm39) missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 155,887,348 (GRCm39) missense probably benign 0.04
IGL02423:Fer1l4 APN 2 155,894,827 (GRCm39) missense probably benign 0.04
IGL02596:Fer1l4 APN 2 155,881,052 (GRCm39) missense probably benign
IGL02612:Fer1l4 APN 2 155,889,848 (GRCm39) missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 155,871,635 (GRCm39) missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 155,887,648 (GRCm39) missense probably benign
IGL03035:Fer1l4 APN 2 155,864,526 (GRCm39) missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 155,881,286 (GRCm39) unclassified probably benign
IGL03201:Fer1l4 APN 2 155,886,650 (GRCm39) missense probably benign 0.32
IGL03349:Fer1l4 APN 2 155,886,654 (GRCm39) nonsense probably null
R0033:Fer1l4 UTSW 2 155,866,026 (GRCm39) splice site probably benign
R0356:Fer1l4 UTSW 2 155,865,930 (GRCm39) missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 155,894,806 (GRCm39) missense probably benign 0.43
R0504:Fer1l4 UTSW 2 155,894,115 (GRCm39) missense probably benign 0.36
R0731:Fer1l4 UTSW 2 155,865,990 (GRCm39) missense probably benign 0.17
R0800:Fer1l4 UTSW 2 155,887,583 (GRCm39) missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 155,861,233 (GRCm39) missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 155,891,398 (GRCm39) critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 155,888,169 (GRCm39) missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 155,887,553 (GRCm39) missense probably benign 0.00
R1657:Fer1l4 UTSW 2 155,877,518 (GRCm39) missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 155,871,605 (GRCm39) missense probably benign 0.14
R1816:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 155,890,194 (GRCm39) missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 155,881,038 (GRCm39) missense probably benign 0.00
R2219:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 155,894,120 (GRCm39) missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 155,876,968 (GRCm39) missense probably benign 0.01
R3806:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R4274:Fer1l4 UTSW 2 155,862,464 (GRCm39) missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 155,878,559 (GRCm39) missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 155,889,007 (GRCm39) missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 155,887,543 (GRCm39) missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4915:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4917:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4918:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4941:Fer1l4 UTSW 2 155,887,009 (GRCm39) missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 155,891,386 (GRCm39) missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 155,879,286 (GRCm39) nonsense probably null
R5441:Fer1l4 UTSW 2 155,865,177 (GRCm39) missense probably benign 0.00
R5555:Fer1l4 UTSW 2 155,890,109 (GRCm39) missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 155,893,913 (GRCm39) missense probably benign 0.01
R6125:Fer1l4 UTSW 2 155,888,907 (GRCm39) missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 155,890,211 (GRCm39) missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 155,866,902 (GRCm39) missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 155,888,091 (GRCm39) missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 155,871,188 (GRCm39) missense probably damaging 1.00
R6298:Fer1l4 UTSW 2 155,866,660 (GRCm39) missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 155,890,170 (GRCm39) missense probably benign 0.08
R6490:Fer1l4 UTSW 2 155,889,834 (GRCm39) missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 155,887,390 (GRCm39) missense probably benign 0.02
R6516:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 155,889,785 (GRCm39) critical splice donor site probably null
R6740:Fer1l4 UTSW 2 155,873,142 (GRCm39) missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 155,878,650 (GRCm39) missense probably benign 0.05
R7121:Fer1l4 UTSW 2 155,886,477 (GRCm39) missense probably benign 0.13
R7132:Fer1l4 UTSW 2 155,887,546 (GRCm39) missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 155,862,669 (GRCm39) nonsense probably null
R7631:Fer1l4 UTSW 2 155,890,195 (GRCm39) missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 155,862,351 (GRCm39) missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 155,890,854 (GRCm39) missense probably benign
R8021:Fer1l4 UTSW 2 155,864,511 (GRCm39) missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 155,866,555 (GRCm39) missense probably benign 0.03
R8171:Fer1l4 UTSW 2 155,890,151 (GRCm39) missense probably benign 0.29
R8241:Fer1l4 UTSW 2 155,891,585 (GRCm39) missense probably benign
R8245:Fer1l4 UTSW 2 155,886,934 (GRCm39) critical splice donor site probably null
R8280:Fer1l4 UTSW 2 155,891,620 (GRCm39) missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 155,861,680 (GRCm39) missense probably benign 0.17
R8403:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 155,861,310 (GRCm39) missense probably benign 0.00
R8804:Fer1l4 UTSW 2 155,893,914 (GRCm39) missense probably benign 0.28
R8814:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense probably benign 0.04
R8817:Fer1l4 UTSW 2 155,890,143 (GRCm39) missense probably damaging 0.99
R9325:Fer1l4 UTSW 2 155,877,934 (GRCm39) missense probably damaging 1.00
R9342:Fer1l4 UTSW 2 155,877,196 (GRCm39) missense probably benign 0.08
R9527:Fer1l4 UTSW 2 155,871,617 (GRCm39) missense probably damaging 0.96
R9661:Fer1l4 UTSW 2 155,862,336 (GRCm39) missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 155,887,449 (GRCm39) small deletion probably benign
X0063:Fer1l4 UTSW 2 155,876,931 (GRCm39) missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 155,890,349 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTGACTAGGTATAAGCCTGGGC -3'
(R):5'- TGATACCCATCTTGCCCTGG -3'

Sequencing Primer
(F):5'- CTGGGCTCTGAAATCAACAGGATTC -3'
(R):5'- CCAGCTGGGTAAAGGGTCTG -3'
Posted On 2015-06-12