Incidental Mutation 'R4224:Vmn2r14'
ID 319955
Institutional Source Beutler Lab
Gene Symbol Vmn2r14
Ensembl Gene ENSMUSG00000091059
Gene Name vomeronasal 2, receptor 14
Synonyms EG231591
MMRRC Submission 041044-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.526) question?
Stock # R4224 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 109362822-109372488 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109364149 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 589 (M589T)
Ref Sequence ENSEMBL: ENSMUSP00000128015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170341]
AlphaFold E9Q759
Predicted Effect probably benign
Transcript: ENSMUST00000170341
AA Change: M589T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128015
Gene: ENSMUSG00000091059
AA Change: M589T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.3e-31 PFAM
Pfam:NCD3G 507 561 1.1e-17 PFAM
Pfam:7tm_3 594 829 1.2e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 95% (42/44)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182O14Rik T C 15: 40,005,672 (GRCm39) probably null Het
Abl2 A G 1: 156,461,417 (GRCm39) T440A probably damaging Het
Acat2 T C 17: 13,181,772 (GRCm39) probably benign Het
Acsbg1 C T 9: 54,523,325 (GRCm39) R434H possibly damaging Het
Aif1l A T 2: 31,852,251 (GRCm39) S40C probably damaging Het
Atosa T A 9: 74,916,008 (GRCm39) N209K probably damaging Het
Atp6v1a C A 16: 43,922,174 (GRCm39) A355S probably damaging Het
Corin T C 5: 72,500,451 (GRCm39) E391G probably damaging Het
Dnah11 T G 12: 118,094,627 (GRCm39) S814R probably benign Het
Fer1l4 A C 2: 155,862,309 (GRCm39) V1788G probably benign Het
Gm7964 T G 7: 83,406,030 (GRCm39) N281K probably damaging Het
Grin1 T C 2: 25,187,332 (GRCm39) probably benign Het
Ica1 T C 6: 8,659,960 (GRCm39) K112R probably benign Het
Itpr3 T C 17: 27,326,232 (GRCm39) V1334A probably damaging Het
Khdc3 C G 9: 73,010,153 (GRCm39) H70D possibly damaging Het
Lama3 T C 18: 12,583,460 (GRCm39) C683R probably damaging Het
Mettl21a G T 1: 64,647,115 (GRCm39) Y147* probably null Het
Mr1 A T 1: 155,006,465 (GRCm39) I294N possibly damaging Het
Or52z12 A G 7: 103,233,966 (GRCm39) T246A probably damaging Het
Or7e170 T A 9: 19,794,896 (GRCm39) Y235F probably benign Het
Pals1 A G 12: 78,876,492 (GRCm39) K479E probably damaging Het
Pcdhgb7 T A 18: 37,886,856 (GRCm39) D675E probably benign Het
Polr1has T C 17: 37,269,617 (GRCm39) probably benign Het
Ptbp1 T C 10: 79,695,047 (GRCm39) I125T probably benign Het
Rnf213 C T 11: 119,327,649 (GRCm39) R1879* probably null Het
Slc8a1 A G 17: 81,956,781 (GRCm39) F86L probably damaging Het
Spdya G A 17: 71,869,519 (GRCm39) V105I probably benign Het
Sspo G T 6: 48,428,091 (GRCm39) V313L possibly damaging Het
Stard9 A G 2: 120,495,472 (GRCm39) T116A possibly damaging Het
Tnnt1 T C 7: 4,513,006 (GRCm39) H92R probably damaging Het
Trim37 T A 11: 87,107,289 (GRCm39) C907S probably damaging Het
Trim43b T A 9: 88,972,692 (GRCm39) Q154L probably benign Het
Tssk3 T C 4: 129,384,392 (GRCm39) D3G probably benign Het
Ubash3a T C 17: 31,456,902 (GRCm39) Y521H probably damaging Het
Vmn1r73 T C 7: 11,490,506 (GRCm39) I108T probably damaging Het
Vmn2r60 A T 7: 41,765,952 (GRCm39) T20S probably benign Het
Vps13b A G 15: 35,876,565 (GRCm39) T2799A probably damaging Het
Zcchc18 A T X: 135,895,415 (GRCm39) N10I probably damaging Het
Other mutations in Vmn2r14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Vmn2r14 APN 5 109,364,180 (GRCm39) nonsense probably null
IGL01504:Vmn2r14 APN 5 109,369,285 (GRCm39) missense probably benign 0.01
IGL01828:Vmn2r14 APN 5 109,372,443 (GRCm39) missense possibly damaging 0.71
IGL02093:Vmn2r14 APN 5 109,368,275 (GRCm39) missense possibly damaging 0.94
IGL02103:Vmn2r14 APN 5 109,372,349 (GRCm39) missense probably damaging 0.96
IGL02123:Vmn2r14 APN 5 109,367,933 (GRCm39) missense probably damaging 1.00
IGL02145:Vmn2r14 APN 5 109,368,454 (GRCm39) nonsense probably null
IGL02676:Vmn2r14 APN 5 109,367,882 (GRCm39) missense probably benign 0.03
IGL02720:Vmn2r14 APN 5 109,369,305 (GRCm39) missense probably damaging 1.00
IGL02877:Vmn2r14 APN 5 109,368,054 (GRCm39) missense probably damaging 0.99
IGL02974:Vmn2r14 APN 5 109,369,292 (GRCm39) missense possibly damaging 0.55
IGL03151:Vmn2r14 APN 5 109,364,260 (GRCm39) missense probably damaging 1.00
IGL03297:Vmn2r14 APN 5 109,363,973 (GRCm39) missense probably damaging 1.00
IGL03386:Vmn2r14 APN 5 109,368,350 (GRCm39) missense possibly damaging 0.90
IGL03394:Vmn2r14 APN 5 109,367,702 (GRCm39) missense probably null 0.83
ANU74:Vmn2r14 UTSW 5 109,366,910 (GRCm39) missense probably benign 0.00
R0316:Vmn2r14 UTSW 5 109,366,762 (GRCm39) missense probably benign 0.07
R0755:Vmn2r14 UTSW 5 109,364,226 (GRCm39) missense possibly damaging 0.81
R1219:Vmn2r14 UTSW 5 109,372,440 (GRCm39) missense probably benign 0.17
R1321:Vmn2r14 UTSW 5 109,364,117 (GRCm39) missense probably benign 0.08
R1465:Vmn2r14 UTSW 5 109,368,195 (GRCm39) missense possibly damaging 0.47
R1465:Vmn2r14 UTSW 5 109,368,195 (GRCm39) missense possibly damaging 0.47
R1509:Vmn2r14 UTSW 5 109,363,862 (GRCm39) missense probably benign 0.00
R1551:Vmn2r14 UTSW 5 109,369,283 (GRCm39) missense probably damaging 1.00
R1628:Vmn2r14 UTSW 5 109,367,838 (GRCm39) missense probably benign 0.00
R1668:Vmn2r14 UTSW 5 109,366,913 (GRCm39) nonsense probably null
R2013:Vmn2r14 UTSW 5 109,369,109 (GRCm39) missense probably benign 0.00
R2201:Vmn2r14 UTSW 5 109,366,698 (GRCm39) splice site probably null
R2417:Vmn2r14 UTSW 5 109,372,329 (GRCm39) missense probably benign 0.00
R3029:Vmn2r14 UTSW 5 109,363,776 (GRCm39) missense probably damaging 1.00
R3120:Vmn2r14 UTSW 5 109,372,431 (GRCm39) missense probably null 0.00
R3729:Vmn2r14 UTSW 5 109,364,095 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r14 UTSW 5 109,368,033 (GRCm39) missense probably benign 0.02
R3943:Vmn2r14 UTSW 5 109,363,930 (GRCm39) missense probably damaging 1.00
R3944:Vmn2r14 UTSW 5 109,363,930 (GRCm39) missense probably damaging 1.00
R4222:Vmn2r14 UTSW 5 109,364,149 (GRCm39) missense probably benign 0.00
R4239:Vmn2r14 UTSW 5 109,364,277 (GRCm39) critical splice acceptor site probably null
R4240:Vmn2r14 UTSW 5 109,364,277 (GRCm39) critical splice acceptor site probably null
R4782:Vmn2r14 UTSW 5 109,369,370 (GRCm39) missense probably benign 0.01
R4832:Vmn2r14 UTSW 5 109,363,976 (GRCm39) missense probably damaging 1.00
R4884:Vmn2r14 UTSW 5 109,369,384 (GRCm39) splice site probably null
R4896:Vmn2r14 UTSW 5 109,368,246 (GRCm39) missense probably benign 0.19
R5004:Vmn2r14 UTSW 5 109,368,246 (GRCm39) missense probably benign 0.19
R5117:Vmn2r14 UTSW 5 109,363,961 (GRCm39) missense probably benign 0.16
R5285:Vmn2r14 UTSW 5 109,365,442 (GRCm39) missense probably damaging 0.98
R5413:Vmn2r14 UTSW 5 109,369,154 (GRCm39) missense probably benign 0.29
R5569:Vmn2r14 UTSW 5 109,368,261 (GRCm39) missense probably benign 0.44
R5701:Vmn2r14 UTSW 5 109,367,816 (GRCm39) missense probably damaging 1.00
R5726:Vmn2r14 UTSW 5 109,365,486 (GRCm39) missense possibly damaging 0.95
R5763:Vmn2r14 UTSW 5 109,363,724 (GRCm39) missense possibly damaging 0.49
R5872:Vmn2r14 UTSW 5 109,369,222 (GRCm39) missense probably benign
R5985:Vmn2r14 UTSW 5 109,368,082 (GRCm39) missense possibly damaging 0.89
R6268:Vmn2r14 UTSW 5 109,369,283 (GRCm39) missense possibly damaging 0.87
R6273:Vmn2r14 UTSW 5 109,369,133 (GRCm39) missense probably benign 0.44
R6409:Vmn2r14 UTSW 5 109,364,096 (GRCm39) missense probably benign 0.09
R6944:Vmn2r14 UTSW 5 109,364,140 (GRCm39) missense probably benign 0.06
R6944:Vmn2r14 UTSW 5 109,363,925 (GRCm39) missense probably benign 0.22
R7608:Vmn2r14 UTSW 5 109,369,276 (GRCm39) missense probably benign 0.03
R7740:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R7768:Vmn2r14 UTSW 5 109,368,086 (GRCm39) missense probably benign 0.01
R7804:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R7872:Vmn2r14 UTSW 5 109,369,219 (GRCm39) missense probably benign 0.02
R7993:Vmn2r14 UTSW 5 109,363,862 (GRCm39) missense probably benign 0.00
R8006:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R8007:Vmn2r14 UTSW 5 109,368,324 (GRCm39) missense probably benign 0.41
R8187:Vmn2r14 UTSW 5 109,368,420 (GRCm39) missense probably benign 0.03
R8369:Vmn2r14 UTSW 5 109,369,342 (GRCm39) missense probably damaging 1.00
R8463:Vmn2r14 UTSW 5 109,369,340 (GRCm39) missense probably benign 0.30
R8968:Vmn2r14 UTSW 5 109,365,533 (GRCm39) missense probably benign 0.01
R9008:Vmn2r14 UTSW 5 109,367,893 (GRCm39) missense probably benign 0.00
R9030:Vmn2r14 UTSW 5 109,368,054 (GRCm39) missense probably damaging 0.99
R9039:Vmn2r14 UTSW 5 109,367,902 (GRCm39) nonsense probably null
R9150:Vmn2r14 UTSW 5 109,367,783 (GRCm39) missense probably damaging 1.00
R9164:Vmn2r14 UTSW 5 109,364,087 (GRCm39) missense probably damaging 1.00
R9216:Vmn2r14 UTSW 5 109,369,112 (GRCm39) missense probably benign 0.01
R9225:Vmn2r14 UTSW 5 109,369,288 (GRCm39) missense probably damaging 1.00
R9245:Vmn2r14 UTSW 5 109,368,176 (GRCm39) missense possibly damaging 0.89
R9342:Vmn2r14 UTSW 5 109,368,428 (GRCm39) missense probably damaging 1.00
R9472:Vmn2r14 UTSW 5 109,367,962 (GRCm39) missense probably benign 0.00
R9678:Vmn2r14 UTSW 5 109,364,041 (GRCm39) missense probably damaging 1.00
R9774:Vmn2r14 UTSW 5 109,369,126 (GRCm39) missense probably benign 0.07
Z1177:Vmn2r14 UTSW 5 109,367,741 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TCCAAATGTGGTCTGCTGCAG -3'
(R):5'- CCCCACAATAATATGGAATGGAGTTG -3'

Sequencing Primer
(F):5'- CAGGATGCAGGTGGCCTTG -3'
(R):5'- GTGAGGTGTCCAGATGAT -3'
Posted On 2015-06-12