Incidental Mutation 'R4224:Spdya'
ID319983
Institutional Source Beutler Lab
Gene Symbol Spdya
Ensembl Gene ENSMUSG00000052525
Gene Namespeedy/RINGO cell cycle regulator family, member A
Synonymsspeedy/ringo, speedy A2, 4930548B21Rik, 4921517J08Rik, speedy A1, Spdy1
MMRRC Submission 041044-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R4224 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71552061-71589533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71562524 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 105 (V105I)
Ref Sequence ENSEMBL: ENSMUSP00000125912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064420] [ENSMUST00000124001] [ENSMUST00000144142] [ENSMUST00000167641]
Predicted Effect probably benign
Transcript: ENSMUST00000064420
AA Change: V105I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000063214
Gene: ENSMUSG00000052525
AA Change: V105I

DomainStartEndE-ValueType
Pfam:Spy1 68 198 8.2e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124001
AA Change: V105I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118426
Gene: ENSMUSG00000052525
AA Change: V105I

DomainStartEndE-ValueType
Pfam:Spy1 68 198 1.5e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137830
Predicted Effect probably benign
Transcript: ENSMUST00000144142
AA Change: V105I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118994
Gene: ENSMUSG00000052525
AA Change: V105I

DomainStartEndE-ValueType
Pfam:Spy1 68 198 2.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167641
AA Change: V105I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000125912
Gene: ENSMUSG00000052525
AA Change: V105I

DomainStartEndE-ValueType
Pfam:Spy1 68 198 5.1e-69 PFAM
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 95% (42/44)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene results in impaired telomere attachment to the nuclear envelope during early meiosis, abnormal chromosome pairing and homologous synapsis, and meiotic prophase I arrest in male and female germ cells leading to infertility in both sexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182O14Rik T C 15: 40,142,276 probably null Het
Abl2 A G 1: 156,633,847 T440A probably damaging Het
Acat2 T C 17: 12,962,885 probably benign Het
Acsbg1 C T 9: 54,616,041 R434H possibly damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Atp6v1a C A 16: 44,101,811 A355S probably damaging Het
Corin T C 5: 72,343,108 E391G probably damaging Het
Dnah11 T G 12: 118,130,892 S814R probably benign Het
Fam214a T A 9: 75,008,726 N209K probably damaging Het
Fer1l4 A C 2: 156,020,389 V1788G probably benign Het
Gm7964 T G 7: 83,756,822 N281K probably damaging Het
Grin1 T C 2: 25,297,320 probably benign Het
Ica1 T C 6: 8,659,960 K112R probably benign Het
Itpr3 T C 17: 27,107,258 V1334A probably damaging Het
Khdc3 C G 9: 73,102,871 H70D possibly damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Mettl21a G T 1: 64,607,956 Y147* probably null Het
Mpp5 A G 12: 78,829,718 K479E probably damaging Het
Mr1 A T 1: 155,130,719 I294N possibly damaging Het
Olfr617 A G 7: 103,584,759 T246A probably damaging Het
Olfr862 T A 9: 19,883,600 Y235F probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Ptbp1 T C 10: 79,859,213 I125T probably benign Het
Rnf213 C T 11: 119,436,823 R1879* probably null Het
Slc8a1 A G 17: 81,649,352 F86L probably damaging Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Tnnt1 T C 7: 4,510,007 H92R probably damaging Het
Trim37 T A 11: 87,216,463 C907S probably damaging Het
Trim43b T A 9: 89,090,639 Q154L probably benign Het
Tssk3 T C 4: 129,490,599 D3G probably benign Het
Ubash3a T C 17: 31,237,928 Y521H probably damaging Het
Vmn1r73 T C 7: 11,756,579 I108T probably damaging Het
Vmn2r14 A G 5: 109,216,283 M589T probably benign Het
Vmn2r60 A T 7: 42,116,528 T20S probably benign Het
Vps13b A G 15: 35,876,419 T2799A probably damaging Het
Zcchc18 A T X: 136,994,666 N10I probably damaging Het
Znrd1as T C 17: 36,958,725 probably benign Het
Other mutations in Spdya
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Spdya APN 17 71556325 missense possibly damaging 0.51
IGL01667:Spdya APN 17 71556259 start codon destroyed probably null 1.00
IGL02103:Spdya APN 17 71578247 missense probably benign 0.15
IGL02934:Spdya APN 17 71556400 missense probably benign 0.01
IGL03220:Spdya APN 17 71578291 missense possibly damaging 0.87
R0143:Spdya UTSW 17 71558640 missense probably damaging 0.96
R0570:Spdya UTSW 17 71562590 critical splice donor site probably null
R1666:Spdya UTSW 17 71578240 missense probably damaging 1.00
R4019:Spdya UTSW 17 71556314 missense possibly damaging 0.72
R4225:Spdya UTSW 17 71562524 missense probably benign 0.07
R4663:Spdya UTSW 17 71578344 missense probably benign 0.04
R5013:Spdya UTSW 17 71562504 missense possibly damaging 0.91
R5038:Spdya UTSW 17 71588566 intron probably benign
R5583:Spdya UTSW 17 71569131 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCAAGTGGATTAACTCTGGGG -3'
(R):5'- TGGCATGTAATGTAAGGCCAATG -3'

Sequencing Primer
(F):5'- GTACTCAGGTGACTGTATACAG -3'
(R):5'- TAATTTTCCCACACAAGATGGC -3'
Posted On2015-06-12