Incidental Mutation 'R4225:Stpg2'
ID319995
Institutional Source Beutler Lab
Gene Symbol Stpg2
Ensembl Gene ENSMUSG00000047940
Gene Namesperm tail PG rich repeat containing 2
SynonymsLOC381476, B930007M17Rik
MMRRC Submission 041045-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4225 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location139205694-139710299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 139215292 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 86 (R86Q)
Ref Sequence ENSEMBL: ENSMUSP00000101846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062306] [ENSMUST00000106239]
Predicted Effect probably damaging
Transcript: ENSMUST00000062306
AA Change: R86Q

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051539
Gene: ENSMUSG00000047940
AA Change: R86Q

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 20 50 1.1e1 PFAM
Pfam:SHIPPO-rpt 62 92 1.3e1 PFAM
Pfam:SHIPPO-rpt 97 127 9.1e1 PFAM
Pfam:SHIPPO-rpt 162 193 1.3e2 PFAM
Pfam:SHIPPO-rpt 200 235 1.7e0 PFAM
Pfam:SHIPPO-rpt 249 285 1.2e-2 PFAM
Pfam:SHIPPO-rpt 292 315 3.2e1 PFAM
Pfam:SHIPPO-rpt 334 371 2.1e0 PFAM
Pfam:SHIPPO-rpt 421 462 3.8e0 PFAM
Pfam:SHIPPO-rpt 471 497 2.9e1 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106239
AA Change: R86Q

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101846
Gene: ENSMUSG00000047940
AA Change: R86Q

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 200 220 6.9e-1 PFAM
Pfam:SHIPPO-rpt 249 285 8.8e-2 PFAM
Pfam:SHIPPO-rpt 334 371 5.4e-2 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,085,106 I569V possibly damaging Het
AI314180 A T 4: 58,847,027 Y512N probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Arhgef26 A G 3: 62,380,922 D471G probably benign Het
Armc4 A G 18: 7,181,732 probably null Het
Atp2a2 A G 5: 122,469,726 V240A probably benign Het
Bsn A G 9: 108,106,733 M3374T unknown Het
Ccdc66 A G 14: 27,490,779 L529P probably damaging Het
Ctif A G 18: 75,435,237 I610T probably benign Het
Eif3c C G 7: 126,566,299 probably benign Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Gba2 A T 4: 43,569,464 probably benign Het
Grin1 T C 2: 25,297,320 probably benign Het
Herc2 A G 7: 56,164,987 E2696G probably damaging Het
Itgal A T 7: 127,305,312 K319M probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrig1 T A 6: 94,622,658 I348F probably damaging Het
Mc3r G A 2: 172,249,034 V59M probably damaging Het
Msh3 T C 13: 92,285,923 K575R probably benign Het
Musk A T 4: 58,373,240 M714L probably damaging Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pkd1 T C 17: 24,593,523 I3810T possibly damaging Het
Pou2f1 T C 1: 165,911,320 I177V possibly damaging Het
Rb1 T C 14: 73,269,191 M373V possibly damaging Het
Ric1 A G 19: 29,602,731 N1311D possibly damaging Het
Scn3a A G 2: 65,536,427 Y84H probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc8a1 A G 17: 81,649,352 F86L probably damaging Het
Spdya G A 17: 71,562,524 V105I probably benign Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Tdrd6 C T 17: 43,625,973 D1395N probably damaging Het
Vmn2r101 T A 17: 19,611,689 I649N probably damaging Het
Zcchc18 A T X: 136,994,666 N10I probably damaging Het
Other mutations in Stpg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Stpg2 APN 3 139419874 splice site probably benign
IGL01505:Stpg2 APN 3 139317453 missense probably benign 0.02
IGL01649:Stpg2 APN 3 139419862 missense probably damaging 1.00
IGL03264:Stpg2 APN 3 139309209 missense possibly damaging 0.72
PIT4687001:Stpg2 UTSW 3 139215265 missense possibly damaging 0.89
R0053:Stpg2 UTSW 3 139212321 missense probably benign 0.00
R0099:Stpg2 UTSW 3 139243193 splice site probably benign
R0417:Stpg2 UTSW 3 139218321 missense probably damaging 1.00
R1646:Stpg2 UTSW 3 139419702 splice site probably benign
R1719:Stpg2 UTSW 3 139232199 missense probably benign 0.11
R1791:Stpg2 UTSW 3 139317401 missense probably benign 0.00
R1799:Stpg2 UTSW 3 139419781 missense probably damaging 1.00
R1912:Stpg2 UTSW 3 139522981 splice site probably null
R1974:Stpg2 UTSW 3 139309183 nonsense probably null
R3725:Stpg2 UTSW 3 139317477 missense probably benign 0.00
R3727:Stpg2 UTSW 3 139298496 missense probably damaging 1.00
R4694:Stpg2 UTSW 3 139317416 missense possibly damaging 0.94
R4698:Stpg2 UTSW 3 139309229 missense probably damaging 1.00
R4879:Stpg2 UTSW 3 139215373 missense probably benign 0.03
R5236:Stpg2 UTSW 3 139232223 missense probably damaging 1.00
R5476:Stpg2 UTSW 3 139243138 missense probably benign 0.03
R5567:Stpg2 UTSW 3 139419786 missense probably benign 0.22
R6297:Stpg2 UTSW 3 139701671 missense possibly damaging 0.91
R6692:Stpg2 UTSW 3 139522977 critical splice donor site probably null
R7113:Stpg2 UTSW 3 139701774 critical splice donor site probably null
R7154:Stpg2 UTSW 3 139215295 missense probably benign 0.44
R7553:Stpg2 UTSW 3 139218337 missense probably damaging 1.00
R7660:Stpg2 UTSW 3 139701697 missense probably damaging 0.98
RF021:Stpg2 UTSW 3 139212250 critical splice acceptor site probably null
X0009:Stpg2 UTSW 3 139298462 missense probably benign 0.00
X0018:Stpg2 UTSW 3 139243090 missense probably benign 0.44
Z1176:Stpg2 UTSW 3 139701640 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTATGAGCTTAGAGTCAAAACTG -3'
(R):5'- CATCAAACACACTGCTTAGGATTTC -3'

Sequencing Primer
(F):5'- AACTTGGGGTCTCAGCT -3'
(R):5'- GTGACACACTGCAGATGT -3'
Posted On2015-06-12