Incidental Mutation 'R4225:Musk'
ID319998
Institutional Source Beutler Lab
Gene Symbol Musk
Ensembl Gene ENSMUSG00000057280
Gene Namemuscle, skeletal, receptor tyrosine kinase
SynonymsMDK4, Nsk1, Nsk2, Nsk3
MMRRC Submission 041045-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4225 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location58285960-58374303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58373240 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 714 (M714L)
Ref Sequence ENSEMBL: ENSMUSP00000136696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081919] [ENSMUST00000084578] [ENSMUST00000098057] [ENSMUST00000098059] [ENSMUST00000102893] [ENSMUST00000177951] [ENSMUST00000179951]
Predicted Effect probably damaging
Transcript: ENSMUST00000081919
AA Change: M712L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080590
Gene: ENSMUSG00000057280
AA Change: M712L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.1e-27 PFAM
transmembrane domain 495 517 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
TyrKc 574 855 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000084578
AA Change: M712L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081625
Gene: ENSMUSG00000057280
AA Change: M712L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.2e-28 PFAM
transmembrane domain 495 517 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
TyrKc 574 855 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098057
AA Change: M737L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095665
Gene: ENSMUSG00000057280
AA Change: M737L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
Pfam:Fz 342 467 1.4e-15 PFAM
transmembrane domain 520 542 N/A INTRINSIC
low complexity region 543 554 N/A INTRINSIC
low complexity region 583 592 N/A INTRINSIC
TyrKc 599 880 2.96e-140 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098059
AA Change: M714L

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095667
Gene: ENSMUSG00000057280
AA Change: M714L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
low complexity region 303 318 N/A INTRINSIC
Pfam:Fz 327 458 2.1e-28 PFAM
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 520 531 N/A INTRINSIC
low complexity region 560 569 N/A INTRINSIC
TyrKc 576 857 2.96e-140 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102893
AA Change: M704L

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099957
Gene: ENSMUSG00000057280
AA Change: M704L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 224 289 4.67e-4 SMART
Pfam:Fz 317 448 1.1e-27 PFAM
transmembrane domain 487 509 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
TyrKc 566 847 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177951
AA Change: M714L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136696
Gene: ENSMUSG00000057280
AA Change: M714L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
Pfam:Fz 327 458 1.1e-27 PFAM
transmembrane domain 497 519 N/A INTRINSIC
low complexity region 520 531 N/A INTRINSIC
low complexity region 560 569 N/A INTRINSIC
TyrKc 576 857 2.96e-140 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179951
AA Change: M722L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137453
Gene: ENSMUSG00000057280
AA Change: M722L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 40 106 1.16e-8 SMART
IGc2 133 197 1.79e-14 SMART
IGc2 234 299 4.67e-4 SMART
low complexity region 303 318 N/A INTRINSIC
Pfam:Fz 327 458 1.2e-27 PFAM
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
TyrKc 584 865 2.96e-140 SMART
Meta Mutation Damage Score 0.4066 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: This gene encodes a member of the protein tyrosine kinase family. The encoded protein is a type 1 receptor-like protein located in muscle membrane that is activated by the heparan sulfate proteoglycan agrin released by nerve cells. The encoded protein activates signaling cascades responsible for multiple aspects of motor neuron and muscle development, including organization of the postsynaptic membrane, synaptic gene transcription, patterning of skeletal muscle, anchoring of acetylcholinesterase, and guidance of motor axons. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation lack neuromuscular synapses and spontaneous movement, and die at birth of respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,085,106 I569V possibly damaging Het
AI314180 A T 4: 58,847,027 Y512N probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Arhgef26 A G 3: 62,380,922 D471G probably benign Het
Armc4 A G 18: 7,181,732 probably null Het
Atp2a2 A G 5: 122,469,726 V240A probably benign Het
Bsn A G 9: 108,106,733 M3374T unknown Het
Ccdc66 A G 14: 27,490,779 L529P probably damaging Het
Ctif A G 18: 75,435,237 I610T probably benign Het
Eif3c C G 7: 126,566,299 probably benign Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Gba2 A T 4: 43,569,464 probably benign Het
Grin1 T C 2: 25,297,320 probably benign Het
Herc2 A G 7: 56,164,987 E2696G probably damaging Het
Itgal A T 7: 127,305,312 K319M probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrig1 T A 6: 94,622,658 I348F probably damaging Het
Mc3r G A 2: 172,249,034 V59M probably damaging Het
Msh3 T C 13: 92,285,923 K575R probably benign Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pkd1 T C 17: 24,593,523 I3810T possibly damaging Het
Pou2f1 T C 1: 165,911,320 I177V possibly damaging Het
Rb1 T C 14: 73,269,191 M373V possibly damaging Het
Ric1 A G 19: 29,602,731 N1311D possibly damaging Het
Scn3a A G 2: 65,536,427 Y84H probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc8a1 A G 17: 81,649,352 F86L probably damaging Het
Spdya G A 17: 71,562,524 V105I probably benign Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Stpg2 G A 3: 139,215,292 R86Q probably damaging Het
Tdrd6 C T 17: 43,625,973 D1395N probably damaging Het
Vmn2r101 T A 17: 19,611,689 I649N probably damaging Het
Zcchc18 A T X: 136,994,666 N10I probably damaging Het
Other mutations in Musk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Musk APN 4 58367539 missense probably damaging 1.00
IGL01727:Musk APN 4 58303887 missense probably benign 0.37
IGL01981:Musk APN 4 58296629 missense probably damaging 1.00
IGL02064:Musk APN 4 58286128 missense possibly damaging 0.89
IGL02326:Musk APN 4 58354113 missense probably benign 0.02
IGL02475:Musk APN 4 58353936 critical splice acceptor site probably benign
IGL02585:Musk APN 4 58347849 missense probably benign
IGL02719:Musk APN 4 58356496 missense probably benign
IGL02797:Musk APN 4 58366921 missense probably benign 0.00
IGL02869:Musk APN 4 58354078 missense probably benign 0.05
IGL02940:Musk APN 4 58373364 missense probably damaging 1.00
IGL03167:Musk APN 4 58366821 missense possibly damaging 0.81
IGL03230:Musk APN 4 58296710 missense probably damaging 1.00
R0384:Musk UTSW 4 58373711 makesense probably null
R1014:Musk UTSW 4 58354156 missense possibly damaging 0.88
R1462:Musk UTSW 4 58286204 splice site probably benign
R1493:Musk UTSW 4 58354003 missense probably benign 0.19
R1739:Musk UTSW 4 58293563 missense probably damaging 1.00
R1883:Musk UTSW 4 58373189 missense probably benign 0.18
R2230:Musk UTSW 4 58333672 missense possibly damaging 0.79
R2914:Musk UTSW 4 58366938 missense probably damaging 0.99
R3508:Musk UTSW 4 58327347 missense probably damaging 0.98
R4601:Musk UTSW 4 58301625 missense probably damaging 0.99
R4771:Musk UTSW 4 58301706 missense probably benign 0.16
R4793:Musk UTSW 4 58373400 missense probably damaging 1.00
R4845:Musk UTSW 4 58296679 missense probably damaging 1.00
R4919:Musk UTSW 4 58366899 missense probably damaging 1.00
R4954:Musk UTSW 4 58344222 missense probably damaging 0.96
R5596:Musk UTSW 4 58373036 missense probably damaging 1.00
R5715:Musk UTSW 4 58333663 missense probably damaging 1.00
R5894:Musk UTSW 4 58373583 missense probably damaging 1.00
R5934:Musk UTSW 4 58373613 missense probably damaging 1.00
R6230:Musk UTSW 4 58367576 missense probably damaging 1.00
R6335:Musk UTSW 4 58366811 missense probably benign
R6358:Musk UTSW 4 58373171 missense possibly damaging 0.72
R6395:Musk UTSW 4 58286169 missense probably benign
R6652:Musk UTSW 4 58368977 missense probably damaging 1.00
R6764:Musk UTSW 4 58354027 missense probably damaging 1.00
R7233:Musk UTSW 4 58373307 missense possibly damaging 0.83
R7238:Musk UTSW 4 58344312 missense probably benign 0.01
R7271:Musk UTSW 4 58373409 missense probably damaging 1.00
R7511:Musk UTSW 4 58333672 missense probably benign 0.10
X0020:Musk UTSW 4 58368996 missense probably damaging 1.00
X0066:Musk UTSW 4 58327356 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCTGCTCTTTGAATATATGGCC -3'
(R):5'- ACATCCGACTCAGTGGTGTAG -3'

Sequencing Primer
(F):5'- GCCTATGGTGACCTCAATGAG -3'
(R):5'- AGATAGACTCGGGCGGCATC -3'
Posted On2015-06-12