Incidental Mutation 'R4225:Lrig1'
ID320002
Institutional Source Beutler Lab
Gene Symbol Lrig1
Ensembl Gene ENSMUSG00000030029
Gene Nameleucine-rich repeats and immunoglobulin-like domains 1
SynonymsLIG-1, Img
MMRRC Submission 041045-MU
Accession Numbers

Genbank: NM_008377; MGI: 107935

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4225 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location94604529-94700158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94622658 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 348 (I348F)
Ref Sequence ENSEMBL: ENSMUSP00000144963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032105] [ENSMUST00000101126] [ENSMUST00000204645]
Predicted Effect probably damaging
Transcript: ENSMUST00000032105
AA Change: I348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032105
Gene: ENSMUSG00000030029
AA Change: I348F

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000101126
AA Change: I348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098686
Gene: ENSMUSG00000030029
AA Change: I348F

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150811
Predicted Effect probably damaging
Transcript: ENSMUST00000204645
AA Change: I348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144963
Gene: ENSMUSG00000030029
AA Change: I348F

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Meta Mutation Damage Score 0.2056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype Strain: 2675424
PHENOTYPE: Homozygous null mice developed psoriasiform epidermal hyperplasia. Homozygotes exhibit hair follicle, epidermis, vertebral, eye and hearing abnormalities, decreased body size and fat amount, and increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,085,106 I569V possibly damaging Het
AI314180 A T 4: 58,847,027 Y512N probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Arhgef26 A G 3: 62,380,922 D471G probably benign Het
Armc4 A G 18: 7,181,732 probably null Het
Atp2a2 A G 5: 122,469,726 V240A probably benign Het
Bsn A G 9: 108,106,733 M3374T unknown Het
Ccdc66 A G 14: 27,490,779 L529P probably damaging Het
Ctif A G 18: 75,435,237 I610T probably benign Het
Eif3c C G 7: 126,566,299 probably benign Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Gba2 A T 4: 43,569,464 probably benign Het
Grin1 T C 2: 25,297,320 probably benign Het
Herc2 A G 7: 56,164,987 E2696G probably damaging Het
Itgal A T 7: 127,305,312 K319M probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Mc3r G A 2: 172,249,034 V59M probably damaging Het
Msh3 T C 13: 92,285,923 K575R probably benign Het
Musk A T 4: 58,373,240 M714L probably damaging Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pkd1 T C 17: 24,593,523 I3810T possibly damaging Het
Pou2f1 T C 1: 165,911,320 I177V possibly damaging Het
Rb1 T C 14: 73,269,191 M373V possibly damaging Het
Ric1 A G 19: 29,602,731 N1311D possibly damaging Het
Scn3a A G 2: 65,536,427 Y84H probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc8a1 A G 17: 81,649,352 F86L probably damaging Het
Spdya G A 17: 71,562,524 V105I probably benign Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Stpg2 G A 3: 139,215,292 R86Q probably damaging Het
Tdrd6 C T 17: 43,625,973 D1395N probably damaging Het
Vmn2r101 T A 17: 19,611,689 I649N probably damaging Het
Zcchc18 A T X: 136,994,666 N10I probably damaging Het
Other mutations in Lrig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Lrig1 APN 6 94611404 missense probably damaging 0.99
IGL01356:Lrig1 APN 6 94654920 missense probably benign 0.00
IGL01356:Lrig1 APN 6 94609893 missense probably damaging 1.00
IGL02001:Lrig1 APN 6 94607324 missense probably benign 0.00
IGL02019:Lrig1 APN 6 94616429 missense probably damaging 0.98
IGL02177:Lrig1 APN 6 94663996 missense possibly damaging 0.76
IGL02274:Lrig1 APN 6 94663938 missense possibly damaging 0.90
IGL03197:Lrig1 APN 6 94606118 missense probably benign
IGL03263:Lrig1 APN 6 94611647 missense probably benign 0.00
IGL03327:Lrig1 APN 6 94606123 missense probably benign 0.10
N/A - 293:Lrig1 UTSW 6 94609087 missense probably benign
R0019:Lrig1 UTSW 6 94607349 nonsense probably null
R0019:Lrig1 UTSW 6 94607349 nonsense probably null
R0961:Lrig1 UTSW 6 94663914 splice site probably benign
R1018:Lrig1 UTSW 6 94622602 splice site probably benign
R1381:Lrig1 UTSW 6 94606130 missense probably benign 0.04
R1473:Lrig1 UTSW 6 94607313 missense probably benign 0.16
R1498:Lrig1 UTSW 6 94627987 missense possibly damaging 0.89
R1888:Lrig1 UTSW 6 94654878 missense probably benign 0.03
R1888:Lrig1 UTSW 6 94654878 missense probably benign 0.03
R2273:Lrig1 UTSW 6 94608143 missense probably damaging 1.00
R2513:Lrig1 UTSW 6 94617366 intron probably null
R3001:Lrig1 UTSW 6 94608777 missense probably damaging 1.00
R3002:Lrig1 UTSW 6 94608777 missense probably damaging 1.00
R3732:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3732:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3733:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3772:Lrig1 UTSW 6 94605817 missense probably benign 0.00
R4089:Lrig1 UTSW 6 94609859 missense possibly damaging 0.83
R4093:Lrig1 UTSW 6 94613578 missense probably benign 0.10
R4095:Lrig1 UTSW 6 94613578 missense probably benign 0.10
R4917:Lrig1 UTSW 6 94609719 missense probably damaging 1.00
R4951:Lrig1 UTSW 6 94663978 missense probably damaging 1.00
R4976:Lrig1 UTSW 6 94625062 missense probably damaging 1.00
R5000:Lrig1 UTSW 6 94611449 missense probably damaging 1.00
R5149:Lrig1 UTSW 6 94628044 missense possibly damaging 0.93
R5732:Lrig1 UTSW 6 94699539 nonsense probably null
R5988:Lrig1 UTSW 6 94628042 missense probably damaging 0.99
R6064:Lrig1 UTSW 6 94626447 missense probably damaging 1.00
R6292:Lrig1 UTSW 6 94616445 missense probably damaging 1.00
R6723:Lrig1 UTSW 6 94626405 missense probably damaging 1.00
R6815:Lrig1 UTSW 6 94625029 missense probably damaging 1.00
R6889:Lrig1 UTSW 6 94625063 missense probably benign 0.07
R6995:Lrig1 UTSW 6 94611629 missense possibly damaging 0.95
R7404:Lrig1 UTSW 6 94626471 missense probably damaging 1.00
R7487:Lrig1 UTSW 6 94606118 missense probably benign
R7732:Lrig1 UTSW 6 94626377 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACCAGCTTACAGCCCAATTCTG -3'
(R):5'- TGTGGACATGCTTCAGTCTC -3'

Sequencing Primer
(F):5'- TTCTGACTACAAGCCAGCAAGAGG -3'
(R):5'- TGTCTCCAGGGAGGTCAG -3'
Posted On2015-06-12