Mutagenetix > Incidental Mutations

Incidental Mutation 'R4225:Lrig1'

320002

Institutional Source

Beutler Lab

Gene Symbol

Lrig1

Ensembl Gene

ENSMUSG00000030029

Gene Name

leucine-rich repeats and immunoglobulin-like domains 1

Synonyms

LIG-1, Img

MMRRC Submission

041045-MU

Accession Numbers

Genbank: NM_008377; MGI: 107935

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4225 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94604529-94700158 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 94622658 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 348 (I348F)

Ref Sequence

ENSEMBL: ENSMUSP00000144963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032105] [ENSMUST00000101126] [ENSMUST00000204645]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032105
AA Change: I348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000032105
Gene: ENSMUSG00000030029
AA Change: I348F

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
LRRNT	42	74	5.82e-6	SMART
LRR	68	92	4.83e0	SMART
LRR	93	115	9.96e-1	SMART
LRR	142	163	6.22e0	SMART
LRR	166	187	1.81e1	SMART
LRR	190	212	5.72e0	SMART
LRR	213	235	1.06e1	SMART
LRR_TYP	236	259	2.79e-4	SMART
LRR	260	283	2.54e1	SMART
LRR	284	307	9.96e-1	SMART
LRR	308	331	4.21e1	SMART
LRR_TYP	332	355	8.6e-5	SMART
LRR	356	382	1.06e1	SMART
LRR	383	406	9.96e-1	SMART
LRR_TYP	407	430	3.34e-2	SMART
LRRCT	442	492	3.5e-15	SMART
IGc2	509	586	1.34e-4	SMART
IGc2	613	681	2.87e-13	SMART
IGc2	707	772	6.44e-16	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000101126
AA Change: I348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000098686
Gene: ENSMUSG00000030029
AA Change: I348F

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
LRRNT	42	74	5.82e-6	SMART
LRR	68	92	4.83e0	SMART
LRR	93	115	9.96e-1	SMART
LRR	142	163	6.22e0	SMART
LRR	166	187	1.81e1	SMART
LRR	190	212	5.72e0	SMART
LRR	213	235	1.06e1	SMART
LRR_TYP	236	259	2.79e-4	SMART
LRR	260	283	2.54e1	SMART
LRR	284	307	9.96e-1	SMART
LRR	308	331	4.21e1	SMART
LRR_TYP	332	355	8.6e-5	SMART
LRR	356	382	1.06e1	SMART
LRR	383	406	9.96e-1	SMART
LRR_TYP	407	430	3.34e-2	SMART
LRRCT	442	492	3.5e-15	SMART
IGc2	509	586	1.34e-4	SMART
IGc2	613	681	2.87e-13	SMART
IGc2	707	772	6.44e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150811

Predicted Effect

probably damaging
Transcript: ENSMUST00000204645
AA Change: I348F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000144963
Gene: ENSMUSG00000030029
AA Change: I348F

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
LRRNT	42	74	5.82e-6	SMART
LRR	68	92	4.83e0	SMART
LRR	93	115	9.96e-1	SMART
LRR	142	163	6.22e0	SMART
LRR	166	187	1.81e1	SMART
LRR	190	212	5.72e0	SMART
LRR	213	235	1.06e1	SMART
LRR_TYP	236	259	2.79e-4	SMART
LRR	260	283	2.54e1	SMART
LRR	284	307	9.96e-1	SMART
LRR	308	331	4.21e1	SMART
LRR_TYP	332	355	8.6e-5	SMART
LRR	356	382	1.06e1	SMART
LRR	383	406	9.96e-1	SMART
LRR_TYP	407	430	3.34e-2	SMART
LRRCT	442	492	3.5e-15	SMART
IGc2	509	586	1.34e-4	SMART
IGc2	613	681	2.87e-13	SMART
IGc2	707	772	6.44e-16	SMART

Meta Mutation Damage Score

0.2056

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.6%
20x: 96.1%

Validation Efficiency

100% (38/38)

MGI Phenotype

Strain: 2675424
PHENOTYPE: Homozygous null mice developed psoriasiform epidermal hyperplasia. Homozygotes exhibit hair follicle, epidermis, vertebral, eye and hearing abnormalities, decreased body size and fat amount, and increased susceptibility to bacterial infection. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	T	C	4: 53,085,106	I569V	possibly damaging	Het
AI314180	A	T	4: 58,847,027	Y512N	probably damaging	Het
Aif1l	A	T	2: 31,962,239	S40C	probably damaging	Het
Arhgef26	A	G	3: 62,380,922	D471G	probably benign	Het
Armc4	A	G	18: 7,181,732		probably null	Het
Atp2a2	A	G	5: 122,469,726	V240A	probably benign	Het
Bsn	A	G	9: 108,106,733	M3374T	unknown	Het
Ccdc66	A	G	14: 27,490,779	L529P	probably damaging	Het
Ctif	A	G	18: 75,435,237	I610T	probably benign	Het
Eif3c	C	G	7: 126,566,299		probably benign	Het
Esyt1	T	C	10: 128,520,648	Y376C	probably damaging	Het
Gba2	A	T	4: 43,569,464		probably benign	Het
Grin1	T	C	2: 25,297,320		probably benign	Het
Herc2	A	G	7: 56,164,987	E2696G	probably damaging	Het
Itgal	A	T	7: 127,305,312	K319M	probably damaging	Het
Lama3	T	C	18: 12,450,403	C683R	probably damaging	Het
Mc3r	G	A	2: 172,249,034	V59M	probably damaging	Het
Msh3	T	C	13: 92,285,923	K575R	probably benign	Het
Musk	A	T	4: 58,373,240	M714L	probably damaging	Het
Pcdhgb7	T	A	18: 37,753,803	D675E	probably benign	Het
Pkd1	T	C	17: 24,593,523	I3810T	possibly damaging	Het
Pou2f1	T	C	1: 165,911,320	I177V	possibly damaging	Het
Rb1	T	C	14: 73,269,191	M373V	possibly damaging	Het
Ric1	A	G	19: 29,602,731	N1311D	possibly damaging	Het
Scn3a	A	G	2: 65,536,427	Y84H	probably damaging	Het
Slc25a45	A	T	19: 5,880,118	I39F	probably damaging	Het
Slc8a1	A	G	17: 81,649,352	F86L	probably damaging	Het
Spdya	G	A	17: 71,562,524	V105I	probably benign	Het
Sspo	G	T	6: 48,451,157	V313L	possibly damaging	Het
Stard9	A	G	2: 120,664,991	T116A	possibly damaging	Het
Stpg2	G	A	3: 139,215,292	R86Q	probably damaging	Het
Tdrd6	C	T	17: 43,625,973	D1395N	probably damaging	Het
Vmn2r101	T	A	17: 19,611,689	I649N	probably damaging	Het
Zcchc18	A	T	X: 136,994,666	N10I	probably damaging	Het

Other mutations in Lrig1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00474:Lrig1	APN	6	94611404	missense	probably damaging	0.99
IGL01356:Lrig1	APN	6	94654920	missense	probably benign	0.00
IGL01356:Lrig1	APN	6	94609893	missense	probably damaging	1.00
IGL02001:Lrig1	APN	6	94607324	missense	probably benign	0.00
IGL02019:Lrig1	APN	6	94616429	missense	probably damaging	0.98
IGL02177:Lrig1	APN	6	94663996	missense	possibly damaging	0.76
IGL02274:Lrig1	APN	6	94663938	missense	possibly damaging	0.90
IGL03197:Lrig1	APN	6	94606118	missense	probably benign
IGL03263:Lrig1	APN	6	94611647	missense	probably benign	0.00
IGL03327:Lrig1	APN	6	94606123	missense	probably benign	0.10
N/A - 293:Lrig1	UTSW	6	94609087	missense	probably benign
R0019:Lrig1	UTSW	6	94607349	nonsense	probably null
R0019:Lrig1	UTSW	6	94607349	nonsense	probably null
R0961:Lrig1	UTSW	6	94663914	splice site	probably benign
R1018:Lrig1	UTSW	6	94622602	splice site	probably benign
R1381:Lrig1	UTSW	6	94606130	missense	probably benign	0.04
R1473:Lrig1	UTSW	6	94607313	missense	probably benign	0.16
R1498:Lrig1	UTSW	6	94627987	missense	possibly damaging	0.89
R1888:Lrig1	UTSW	6	94654878	missense	probably benign	0.03
R1888:Lrig1	UTSW	6	94654878	missense	probably benign	0.03
R2273:Lrig1	UTSW	6	94608143	missense	probably damaging	1.00
R2513:Lrig1	UTSW	6	94617366	splice site	probably null
R3001:Lrig1	UTSW	6	94608777	missense	probably damaging	1.00
R3002:Lrig1	UTSW	6	94608777	missense	probably damaging	1.00
R3732:Lrig1	UTSW	6	94611576	missense	possibly damaging	0.86
R3732:Lrig1	UTSW	6	94611576	missense	possibly damaging	0.86
R3733:Lrig1	UTSW	6	94611576	missense	possibly damaging	0.86
R3772:Lrig1	UTSW	6	94605817	missense	probably benign	0.00
R4089:Lrig1	UTSW	6	94609859	missense	possibly damaging	0.83
R4093:Lrig1	UTSW	6	94613578	missense	probably benign	0.10
R4095:Lrig1	UTSW	6	94613578	missense	probably benign	0.10
R4917:Lrig1	UTSW	6	94609719	missense	probably damaging	1.00
R4951:Lrig1	UTSW	6	94663978	missense	probably damaging	1.00
R4976:Lrig1	UTSW	6	94625062	missense	probably damaging	1.00
R5000:Lrig1	UTSW	6	94611449	missense	probably damaging	1.00
R5149:Lrig1	UTSW	6	94628044	missense	possibly damaging	0.93
R5732:Lrig1	UTSW	6	94699539	nonsense	probably null
R5988:Lrig1	UTSW	6	94628042	missense	probably damaging	0.99
R6064:Lrig1	UTSW	6	94626447	missense	probably damaging	1.00
R6292:Lrig1	UTSW	6	94616445	missense	probably damaging	1.00
R6723:Lrig1	UTSW	6	94626405	missense	probably damaging	1.00
R6815:Lrig1	UTSW	6	94625029	missense	probably damaging	1.00
R6889:Lrig1	UTSW	6	94625063	missense	probably benign	0.07
R6995:Lrig1	UTSW	6	94611629	missense	possibly damaging	0.95
R7404:Lrig1	UTSW	6	94626471	missense	probably damaging	1.00
R7487:Lrig1	UTSW	6	94606118	missense	probably benign
R7732:Lrig1	UTSW	6	94626377	missense	probably benign	0.05
R7915:Lrig1	UTSW	6	94630101	critical splice donor site	probably null
R8133:Lrig1	UTSW	6	94611629	missense	possibly damaging	0.95
Z1176:Lrig1	UTSW	6	94609026	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- ACCAGCTTACAGCCCAATTCTG -3'
(R):5'- TGTGGACATGCTTCAGTCTC -3'

Sequencing Primer
(F):5'- TTCTGACTACAAGCCAGCAAGAGG -3'
(R):5'- TGTCTCCAGGGAGGTCAG -3'

Posted On

2015-06-12