Mutagenetix > Incidental Mutation

Incidental Mutation 'R0396:Sf3b1'

32001

Institutional Source

Beutler Lab

Gene Symbol

Sf3b1

Ensembl Gene

ENSMUSG00000025982

Gene Name

splicing factor 3b, subunit 1

Synonyms

Targ4, SAP155, Prp10, 2810001M05Rik, SF3b155

MMRRC Submission

038602-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0396 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54985169-55027481 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 55019271 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 53 (G53E)

Ref Sequence

ENSEMBL: ENSMUSP00000139469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027127] [ENSMUST00000191303]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000027127
AA Change: G53E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: G53E

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	65	75	N/A	INTRINSIC
internal_repeat_1	185	276	1.77e-12	PROSPERO
Pfam:SF3b1	329	452	1.2e-51	PFAM
SCOP:d1qbkb_	489	1289	5e-62	SMART
Blast:ARM	593	637	6e-13	BLAST
Blast:ARM	1005	1044	7e-14	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187500

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188419

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188859

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189051

Predicted Effect

probably damaging
Transcript: ENSMUST00000191303
AA Change: G53E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139469
Gene: ENSMUSG00000025982
AA Change: G53E

Domain	Start	End	E-Value	Type
coiled coil region	1	30	N/A	INTRINSIC
low complexity region	65	75	N/A	INTRINSIC

Meta Mutation Damage Score

0.4185

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 89.8%

Validation Efficiency

92% (96/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,268,377	V467A	possibly damaging	Het
4933405L10Rik	G	A	8: 105,709,780	V194I	probably benign	Het
Acsm1	A	T	7: 119,636,455	I133F	probably damaging	Het
Adamts9	T	A	6: 92,798,005	T1676S	probably benign	Het
Adcy4	T	C	14: 55,772,288	D769G	probably benign	Het
Aif1	T	C	17: 35,171,109	*148W	probably null	Het
Akna	C	T	4: 63,392,126		probably benign	Het
Arhgap32	G	A	9: 32,245,255		probably null	Het
Atpaf1	G	A	4: 115,785,252	E92K	possibly damaging	Het
C1s1	T	C	6: 124,533,354	E378G	probably benign	Het
Caprin1	T	A	2: 103,769,569	Q108L	probably damaging	Het
Car13	A	T	3: 14,656,239	H154L	probably benign	Het
Cdon	C	A	9: 35,470,130	N605K	probably damaging	Het
Ceacam10	G	A	7: 24,781,014	G70E	probably damaging	Het
Cfap221	G	A	1: 119,954,200	T286M	probably benign	Het
Cfap61	T	C	2: 145,949,944	F107S	possibly damaging	Het
Coil	C	A	11: 88,981,623	T270N	probably benign	Het
Crocc2	T	G	1: 93,224,214		probably benign	Het
Crot	T	C	5: 8,969,959	E461G	probably damaging	Het
D130052B06Rik	G	T	11: 33,623,391	R41L	unknown	Het
D630045J12Rik	T	C	6: 38,196,736	S166G	possibly damaging	Het
Dennd4a	T	G	9: 64,862,391	V460G	probably damaging	Het
Depdc7	A	T	2: 104,727,323		probably benign	Het
Dgkb	G	A	12: 38,190,135		probably null	Het
Dhx57	T	G	17: 80,274,797	S407R	probably benign	Het
Dnase2a	G	T	8: 84,909,763		probably benign	Het
Dqx1	T	G	6: 83,059,005	M106R	probably benign	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Ephx2	T	G	14: 66,108,063	I151L	probably benign	Het
Gdf3	C	T	6: 122,607,135	G91D	probably damaging	Het
Gm14124	G	A	2: 150,268,053	G221D	probably damaging	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gsdme	T	A	6: 50,221,107	H291L	probably benign	Het
H2-Bl	A	G	17: 36,083,722	I103T	possibly damaging	Het
Hif3a	G	A	7: 17,052,021		probably benign	Het
Hmox2	A	T	16: 4,765,763	I232L	probably benign	Het
Itgb2	A	G	10: 77,561,189	Y686C	probably damaging	Het
Jmjd1c	A	G	10: 67,219,523	T528A	possibly damaging	Het
Kdr	T	C	5: 75,960,728	I541V	possibly damaging	Het
Khdrbs2	C	A	1: 32,519,973	V343L	probably damaging	Het
Kif16b	C	T	2: 142,853,659	R175H	probably damaging	Het
Klri2	T	G	6: 129,740,288	E44A	possibly damaging	Het
Kmt2b	G	T	7: 30,576,755	T1773K	probably damaging	Het
Lair1	A	G	7: 4,010,786	L154P	probably damaging	Het
Larp1b	G	A	3: 40,970,561	V158M	probably damaging	Het
Lgi3	T	A	14: 70,534,840	I275N	probably damaging	Het
Lrba	A	G	3: 86,295,179	N246D	probably damaging	Het
Lrrc45	T	A	11: 120,714,907		probably benign	Het
Mdh2	G	T	5: 135,789,679	V263L	probably benign	Het
Myom1	T	A	17: 71,034,693	V149E	probably damaging	Het
Nanos1	A	T	19: 60,757,041	D259V	probably damaging	Het
Nedd4l	T	A	18: 65,161,654		probably benign	Het
Npas3	A	G	12: 53,831,745	Y150C	probably damaging	Het
Olfr1066	T	C	2: 86,456,019	N84S	possibly damaging	Het
Olfr1129	T	A	2: 87,575,567	V161D	possibly damaging	Het
Olfr1392	A	T	11: 49,293,338	I6F	probably benign	Het
Olfr479	A	T	7: 108,055,963	H327L	probably benign	Het
Olfr672	G	A	7: 104,996,706	A66V	probably damaging	Het
Olfr93	C	T	17: 37,151,555	C139Y	probably damaging	Het
Pde4c	A	G	8: 70,750,076	N637S	probably benign	Het
Pds5b	T	A	5: 150,779,275	V824D	possibly damaging	Het
Pole2	A	T	12: 69,222,386		probably benign	Het
Ppig	C	T	2: 69,735,976		probably benign	Het
Prep	A	G	10: 45,092,676	Y90C	probably damaging	Het
Proca1	A	T	11: 78,194,905	R11S	probably damaging	Het
Prph	T	A	15: 99,056,991	W313R	probably benign	Het
Prune2	C	T	19: 17,123,080	P1983S	probably benign	Het
Ptbp2	G	A	3: 119,724,198		probably benign	Het
Rsph6a	C	T	7: 19,074,106	P398L	probably damaging	Het
Sdk2	T	C	11: 113,829,967	I1379V	probably benign	Het
Slc9a3	T	C	13: 74,157,784		probably null	Het
Smarcal1	A	T	1: 72,626,473	H710L	probably benign	Het
Soat2	GAGAAG	GAG	15: 102,150,707		probably benign	Het
Sptan1	T	C	2: 29,991,033	V438A	probably damaging	Het
Sstr4	T	A	2: 148,396,261	V264D	probably damaging	Het
Susd2	A	G	10: 75,639,911	L418P	probably damaging	Het
Synj1	A	G	16: 90,938,640	V1475A	probably benign	Het
Szt2	G	A	4: 118,376,347		probably benign	Het
Tbc1d4	T	C	14: 101,458,063		probably null	Het
Tesk1	A	G	4: 43,446,000	E311G	probably damaging	Het
Tmed5	A	T	5: 108,126,016	V119E	probably damaging	Het
Tmem260	T	C	14: 48,486,867	S201P	possibly damaging	Het
Tnxb	A	G	17: 34,671,733	Y350C	probably damaging	Het
Tpte	T	C	8: 22,335,608		probably benign	Het
Trim37	A	T	11: 87,146,968	D161V	probably damaging	Het
Trrap	C	A	5: 144,814,556	Q1640K	probably damaging	Het
Tspoap1	T	C	11: 87,776,346		probably benign	Het
Ttk	T	A	9: 83,847,260		probably benign	Het
Vmn1r172	A	G	7: 23,660,532	S281G	probably benign	Het
Vmn1r177	A	G	7: 23,865,597	S285P	probably damaging	Het
Vmn1r231	C	T	17: 20,890,399	V85I	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r118	T	C	17: 55,608,643	I436V	probably benign	Het
Vmn2r12	T	C	5: 109,092,899	K116R	probably benign	Het
Vmn2r28	T	A	7: 5,488,514	I245L	probably benign	Het
Wdr26	A	T	1: 181,180,651		probably benign	Het
Xrcc3	A	T	12: 111,809,957	H67Q	probably benign	Het
Zbbx	A	T	3: 75,078,495	S417T	possibly damaging	Het
Zc3h13	A	G	14: 75,323,482	D504G	unknown	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zyg11b	A	T	4: 108,255,308	F388I	probably damaging	Het

Other mutations in Sf3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Sf3b1	APN	1	54987486	missense	probably damaging	1.00
IGL00815:Sf3b1	APN	1	54996931	splice site	probably benign
IGL01380:Sf3b1	APN	1	54987949	missense	probably damaging	1.00
IGL01390:Sf3b1	APN	1	54987429	missense	probably benign	0.17
IGL02974:Sf3b1	APN	1	55007707	missense	probably benign	0.00
IGL03159:Sf3b1	APN	1	55012213	missense	probably benign
Colt	UTSW	1	54997156	missense	probably benign	0.45
Glock	UTSW	1	55001046	missense	probably damaging	0.96
Handgun	UTSW	1	55007507	missense	probably damaging	1.00
Kalashnikov	UTSW	1	55019265	missense	probably damaging	0.99
Magazine	UTSW	1	55012182	nonsense	probably null
Revolver	UTSW	1	55019389	nonsense	probably null
R0053:Sf3b1	UTSW	1	55000373	nonsense	probably null
R0053:Sf3b1	UTSW	1	55000373	nonsense	probably null
R0190:Sf3b1	UTSW	1	54990306	missense	probably damaging	0.99
R0277:Sf3b1	UTSW	1	55019257	missense	probably damaging	0.99
R0323:Sf3b1	UTSW	1	55019257	missense	probably damaging	0.99
R0369:Sf3b1	UTSW	1	54998108	missense	probably benign	0.10
R0718:Sf3b1	UTSW	1	55019385	missense	probably damaging	0.99
R0991:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1082:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1083:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1084:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1196:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1376:Sf3b1	UTSW	1	55019265	missense	probably damaging	0.99
R1376:Sf3b1	UTSW	1	55019265	missense	probably damaging	0.99
R1381:Sf3b1	UTSW	1	55003154	missense	probably damaging	0.99
R1436:Sf3b1	UTSW	1	55001421	missense	possibly damaging	0.72
R1559:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1560:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1561:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1567:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1568:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1588:Sf3b1	UTSW	1	54997177	missense	probably benign	0.05
R1625:Sf3b1	UTSW	1	55019377	missense	probably damaging	1.00
R1694:Sf3b1	UTSW	1	55019395	missense	possibly damaging	0.89
R1735:Sf3b1	UTSW	1	55000652	missense	probably damaging	1.00
R1900:Sf3b1	UTSW	1	54998188	missense	possibly damaging	0.75
R2186:Sf3b1	UTSW	1	55007633	missense	probably benign
R2429:Sf3b1	UTSW	1	55016801	missense	possibly damaging	0.71
R2473:Sf3b1	UTSW	1	54999626	critical splice donor site	probably null
R3772:Sf3b1	UTSW	1	54999991	intron	probably benign
R3911:Sf3b1	UTSW	1	55019389	nonsense	probably null
R3970:Sf3b1	UTSW	1	55012182	nonsense	probably null
R4706:Sf3b1	UTSW	1	54990507	missense	probably damaging	1.00
R4707:Sf3b1	UTSW	1	54990507	missense	probably damaging	1.00
R4964:Sf3b1	UTSW	1	54999712	missense	probably benign
R5053:Sf3b1	UTSW	1	54997177	missense	probably benign	0.05
R5358:Sf3b1	UTSW	1	55003310	missense	probably benign	0.09
R5379:Sf3b1	UTSW	1	55003150	missense	possibly damaging	0.94
R5628:Sf3b1	UTSW	1	54998175	missense	probably benign	0.27
R5636:Sf3b1	UTSW	1	54997193	missense	probably damaging	1.00
R6013:Sf3b1	UTSW	1	55000298	missense	probably damaging	0.98
R6149:Sf3b1	UTSW	1	55007507	missense	probably damaging	1.00
R6217:Sf3b1	UTSW	1	55007518	missense	probably damaging	1.00
R6426:Sf3b1	UTSW	1	54999655	missense	probably benign	0.01
R6531:Sf3b1	UTSW	1	55019395	missense	probably damaging	0.99
R6945:Sf3b1	UTSW	1	54997156	missense	probably benign	0.45
R7001:Sf3b1	UTSW	1	55001046	missense	probably damaging	0.96
R7001:Sf3b1	UTSW	1	55014481	critical splice donor site	probably null
R7302:Sf3b1	UTSW	1	55016790	missense	probably benign	0.00
R7644:Sf3b1	UTSW	1	54997143	nonsense	probably null
R7664:Sf3b1	UTSW	1	54987467	missense	probably damaging	1.00
R7735:Sf3b1	UTSW	1	55003349	missense	probably benign	0.29
R7809:Sf3b1	UTSW	1	54995455	missense	possibly damaging	0.60
R8516:Sf3b1	UTSW	1	55012103	missense	probably null	0.01
R8871:Sf3b1	UTSW	1	54990349	missense	probably damaging	1.00
R8947:Sf3b1	UTSW	1	55000285	missense	probably damaging	1.00
R9216:Sf3b1	UTSW	1	55012217	missense	probably benign	0.00
Z1177:Sf3b1	UTSW	1	55003402	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCCAGTGAGGACCCTAGTATTAAGC -3'
(R):5'- TCCTTTCACCTGATGAGGTCAGGAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- ATTCAAGGCAAGAAGGCAGC -3'

Posted On

2013-04-24