Incidental Mutation 'R4225:Ccdc66'
ID320011
Institutional Source Beutler Lab
Gene Symbol Ccdc66
Ensembl Gene ENSMUSG00000046753
Gene Namecoiled-coil domain containing 66
SynonymsE230015L20Rik
MMRRC Submission 041045-MU
Accession Numbers

Genbank: NM_177111.3; Ensembl: ENSMUST00000050480

Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R4225 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location27481090-27508460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27490779 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 529 (L529P)
Ref Sequence ENSEMBL: ENSMUSP00000153023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050480] [ENSMUST00000223689]
Predicted Effect probably damaging
Transcript: ENSMUST00000050480
AA Change: L373P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052546
Gene: ENSMUSG00000046753
AA Change: L373P

DomainStartEndE-ValueType
coiled coil region 252 284 N/A INTRINSIC
Pfam:CCDC66 409 561 1e-49 PFAM
low complexity region 715 721 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157990
Predicted Effect probably damaging
Transcript: ENSMUST00000223689
AA Change: L529P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4736 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display slowly progressing photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,085,106 I569V possibly damaging Het
AI314180 A T 4: 58,847,027 Y512N probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Arhgef26 A G 3: 62,380,922 D471G probably benign Het
Armc4 A G 18: 7,181,732 probably null Het
Atp2a2 A G 5: 122,469,726 V240A probably benign Het
Bsn A G 9: 108,106,733 M3374T unknown Het
Ctif A G 18: 75,435,237 I610T probably benign Het
Eif3c C G 7: 126,566,299 probably benign Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Gba2 A T 4: 43,569,464 probably benign Het
Grin1 T C 2: 25,297,320 probably benign Het
Herc2 A G 7: 56,164,987 E2696G probably damaging Het
Itgal A T 7: 127,305,312 K319M probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrig1 T A 6: 94,622,658 I348F probably damaging Het
Mc3r G A 2: 172,249,034 V59M probably damaging Het
Msh3 T C 13: 92,285,923 K575R probably benign Het
Musk A T 4: 58,373,240 M714L probably damaging Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pkd1 T C 17: 24,593,523 I3810T possibly damaging Het
Pou2f1 T C 1: 165,911,320 I177V possibly damaging Het
Rb1 T C 14: 73,269,191 M373V possibly damaging Het
Ric1 A G 19: 29,602,731 N1311D possibly damaging Het
Scn3a A G 2: 65,536,427 Y84H probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc8a1 A G 17: 81,649,352 F86L probably damaging Het
Spdya G A 17: 71,562,524 V105I probably benign Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Stpg2 G A 3: 139,215,292 R86Q probably damaging Het
Tdrd6 C T 17: 43,625,973 D1395N probably damaging Het
Vmn2r101 T A 17: 19,611,689 I649N probably damaging Het
Zcchc18 A T X: 136,994,666 N10I probably damaging Het
Other mutations in Ccdc66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Ccdc66 APN 14 27498456 missense probably damaging 1.00
IGL01333:Ccdc66 APN 14 27493315 missense possibly damaging 0.60
IGL01684:Ccdc66 APN 14 27500249 missense possibly damaging 0.66
IGL02327:Ccdc66 APN 14 27493386 missense probably damaging 1.00
IGL02668:Ccdc66 APN 14 27497341 missense possibly damaging 0.94
IGL02698:Ccdc66 APN 14 27490792 nonsense probably null
IGL03293:Ccdc66 APN 14 27490671 missense probably damaging 1.00
1mM(1):Ccdc66 UTSW 14 27498775 missense possibly damaging 0.75
IGL02796:Ccdc66 UTSW 14 27486566 missense possibly damaging 0.93
R0374:Ccdc66 UTSW 14 27498473 missense probably damaging 1.00
R0381:Ccdc66 UTSW 14 27491933 missense probably damaging 1.00
R0498:Ccdc66 UTSW 14 27500240 critical splice donor site probably null
R0831:Ccdc66 UTSW 14 27497356 missense probably benign 0.00
R0969:Ccdc66 UTSW 14 27497362 missense probably damaging 0.98
R1558:Ccdc66 UTSW 14 27486506 missense probably benign 0.41
R2203:Ccdc66 UTSW 14 27486833 missense probably benign 0.03
R4015:Ccdc66 UTSW 14 27483836 missense probably damaging 1.00
R4584:Ccdc66 UTSW 14 27500511 missense probably benign 0.31
R4600:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4601:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4603:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4610:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4611:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4832:Ccdc66 UTSW 14 27500567 missense probably benign 0.00
R5098:Ccdc66 UTSW 14 27498793 missense probably damaging 1.00
R5322:Ccdc66 UTSW 14 27482527 missense probably damaging 1.00
R5586:Ccdc66 UTSW 14 27506711 missense probably damaging 1.00
R5681:Ccdc66 UTSW 14 27486741 missense probably benign 0.07
R5788:Ccdc66 UTSW 14 27498491 missense probably benign 0.10
R5790:Ccdc66 UTSW 14 27500447 missense possibly damaging 0.62
R6329:Ccdc66 UTSW 14 27486484 missense probably benign 0.20
R7171:Ccdc66 UTSW 14 27493272 missense possibly damaging 0.94
R7268:Ccdc66 UTSW 14 27486923 missense probably benign 0.24
R7337:Ccdc66 UTSW 14 27500333 missense probably damaging 1.00
R7348:Ccdc66 UTSW 14 27500336 missense probably damaging 1.00
R7552:Ccdc66 UTSW 14 27498863 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCTTAGGGGAAAAGACTCAATTC -3'
(R):5'- AGAATTTCGCCCTGTTGACTG -3'

Sequencing Primer
(F):5'- CAGCCTGGATGTATCATGT -3'
(R):5'- GACTGTATCTAGACCAGCATCTG -3'
Posted On2015-06-12