Incidental Mutation 'R4225:Tdrd6'
ID320015
Institutional Source Beutler Lab
Gene Symbol Tdrd6
Ensembl Gene ENSMUSG00000040140
Gene Nametudor domain containing 6
Synonyms
MMRRC Submission 041045-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4225 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location43615335-43630299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43625973 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1395 (D1395N)
Ref Sequence ENSEMBL: ENSMUSP00000131277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045717] [ENSMUST00000168073]
Predicted Effect probably damaging
Transcript: ENSMUST00000045717
AA Change: D1395N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035338
Gene: ENSMUSG00000040140
AA Change: D1395N

DomainStartEndE-ValueType
Pfam:TUDOR 14 133 9.9e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2026 2083 9.45e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168073
AA Change: D1395N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131277
Gene: ENSMUSG00000040140
AA Change: D1395N

DomainStartEndE-ValueType
Pfam:TUDOR 12 133 7.2e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2027 2084 9.45e-1 SMART
Meta Mutation Damage Score 0.8589 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tudor domain-containing protein and component of the chromatoid body, a type of ribonucleoprotein granule present in male germ cells. Studies in rodents have demonstrated a role for the encoded protein in spermiogenesis and the nonsense mediated decay (NMD) pathway. This protein is a major autoantigen in human patients with autoimmune polyendocrine syndrome type 1 (APS1). [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit male fertility associated with arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 T C 4: 53,085,106 I569V possibly damaging Het
AI314180 A T 4: 58,847,027 Y512N probably damaging Het
Aif1l A T 2: 31,962,239 S40C probably damaging Het
Arhgef26 A G 3: 62,380,922 D471G probably benign Het
Armc4 A G 18: 7,181,732 probably null Het
Atp2a2 A G 5: 122,469,726 V240A probably benign Het
Bsn A G 9: 108,106,733 M3374T unknown Het
Ccdc66 A G 14: 27,490,779 L529P probably damaging Het
Ctif A G 18: 75,435,237 I610T probably benign Het
Eif3c C G 7: 126,566,299 probably benign Het
Esyt1 T C 10: 128,520,648 Y376C probably damaging Het
Gba2 A T 4: 43,569,464 probably benign Het
Grin1 T C 2: 25,297,320 probably benign Het
Herc2 A G 7: 56,164,987 E2696G probably damaging Het
Itgal A T 7: 127,305,312 K319M probably damaging Het
Lama3 T C 18: 12,450,403 C683R probably damaging Het
Lrig1 T A 6: 94,622,658 I348F probably damaging Het
Mc3r G A 2: 172,249,034 V59M probably damaging Het
Msh3 T C 13: 92,285,923 K575R probably benign Het
Musk A T 4: 58,373,240 M714L probably damaging Het
Pcdhgb7 T A 18: 37,753,803 D675E probably benign Het
Pkd1 T C 17: 24,593,523 I3810T possibly damaging Het
Pou2f1 T C 1: 165,911,320 I177V possibly damaging Het
Rb1 T C 14: 73,269,191 M373V possibly damaging Het
Ric1 A G 19: 29,602,731 N1311D possibly damaging Het
Scn3a A G 2: 65,536,427 Y84H probably damaging Het
Slc25a45 A T 19: 5,880,118 I39F probably damaging Het
Slc8a1 A G 17: 81,649,352 F86L probably damaging Het
Spdya G A 17: 71,562,524 V105I probably benign Het
Sspo G T 6: 48,451,157 V313L possibly damaging Het
Stard9 A G 2: 120,664,991 T116A possibly damaging Het
Stpg2 G A 3: 139,215,292 R86Q probably damaging Het
Vmn2r101 T A 17: 19,611,689 I649N probably damaging Het
Zcchc18 A T X: 136,994,666 N10I probably damaging Het
Other mutations in Tdrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tdrd6 APN 17 43628160 missense probably damaging 0.96
IGL00844:Tdrd6 APN 17 43617196 missense probably benign
IGL00845:Tdrd6 APN 17 43626716 missense probably benign 0.06
IGL01558:Tdrd6 APN 17 43625768 missense probably damaging 1.00
IGL01558:Tdrd6 APN 17 43624766 missense probably benign 0.02
IGL01575:Tdrd6 APN 17 43627980 missense probably benign 0.00
IGL01812:Tdrd6 APN 17 43625174 missense probably benign 0.10
IGL02013:Tdrd6 APN 17 43625946 missense probably benign 0.00
IGL02067:Tdrd6 APN 17 43628209 missense probably damaging 1.00
IGL02112:Tdrd6 APN 17 43629351 missense probably damaging 1.00
IGL02159:Tdrd6 APN 17 43628390 missense probably damaging 1.00
IGL02226:Tdrd6 APN 17 43627202 missense probably damaging 1.00
IGL02416:Tdrd6 APN 17 43624738 missense probably benign 0.39
IGL02577:Tdrd6 APN 17 43626837 missense probably damaging 0.99
IGL02631:Tdrd6 APN 17 43626219 missense probably damaging 1.00
IGL02738:Tdrd6 APN 17 43620446 missense probably benign 0.06
IGL02792:Tdrd6 APN 17 43625027 missense probably benign
IGL02929:Tdrd6 APN 17 43629713 missense possibly damaging 0.61
IGL02934:Tdrd6 APN 17 43627887 missense probably benign 0.42
IGL02954:Tdrd6 APN 17 43627262 missense possibly damaging 0.82
IGL02969:Tdrd6 APN 17 43627549 missense probably damaging 0.98
IGL03006:Tdrd6 APN 17 43625432 missense probably damaging 1.00
IGL03155:Tdrd6 APN 17 43625507 missense probably damaging 1.00
IGL03219:Tdrd6 APN 17 43627964 missense probably benign 0.04
IGL03372:Tdrd6 APN 17 43625568 missense probably damaging 1.00
Elizabeth UTSW 17 43624204 missense probably benign 0.00
henry UTSW 17 43628159 missense probably damaging 0.99
BB001:Tdrd6 UTSW 17 43627806 missense possibly damaging 0.94
BB011:Tdrd6 UTSW 17 43627806 missense possibly damaging 0.94
G1citation:Tdrd6 UTSW 17 43627215 missense probably damaging 1.00
R0030:Tdrd6 UTSW 17 43626591 missense possibly damaging 0.80
R0057:Tdrd6 UTSW 17 43617161 splice site probably benign
R0090:Tdrd6 UTSW 17 43628241 missense probably benign 0.00
R0270:Tdrd6 UTSW 17 43624308 missense probably benign
R0463:Tdrd6 UTSW 17 43625561 missense probably damaging 1.00
R0594:Tdrd6 UTSW 17 43629383 missense probably damaging 1.00
R0650:Tdrd6 UTSW 17 43628159 missense probably damaging 0.99
R1226:Tdrd6 UTSW 17 43626632 missense possibly damaging 0.63
R1309:Tdrd6 UTSW 17 43626621 missense probably benign
R1483:Tdrd6 UTSW 17 43627607 missense probably benign 0.31
R1561:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1574:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1647:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1648:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1723:Tdrd6 UTSW 17 43628327 missense possibly damaging 0.94
R1786:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R1819:Tdrd6 UTSW 17 43626551 missense probably benign 0.00
R1836:Tdrd6 UTSW 17 43625589 missense probably benign 0.03
R1892:Tdrd6 UTSW 17 43624805 missense probably benign 0.00
R1911:Tdrd6 UTSW 17 43627088 missense probably benign 0.21
R1936:Tdrd6 UTSW 17 43626467 missense probably damaging 0.98
R2005:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2006:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2132:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R2133:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R3010:Tdrd6 UTSW 17 43628042 missense probably benign 0.00
R4448:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4449:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4531:Tdrd6 UTSW 17 43628754 missense probably damaging 0.98
R4624:Tdrd6 UTSW 17 43625990 missense probably damaging 0.99
R4665:Tdrd6 UTSW 17 43624116 missense probably benign
R4676:Tdrd6 UTSW 17 43627610 missense probably damaging 0.96
R4785:Tdrd6 UTSW 17 43625576 missense probably damaging 1.00
R4912:Tdrd6 UTSW 17 43624327 missense probably benign 0.34
R5134:Tdrd6 UTSW 17 43626210 missense probably damaging 1.00
R5145:Tdrd6 UTSW 17 43626075 missense probably damaging 0.96
R5623:Tdrd6 UTSW 17 43629333 missense probably damaging 1.00
R5712:Tdrd6 UTSW 17 43626408 missense probably damaging 1.00
R5897:Tdrd6 UTSW 17 43624877 missense probably damaging 0.98
R5913:Tdrd6 UTSW 17 43628411 missense possibly damaging 0.73
R6142:Tdrd6 UTSW 17 43629482 missense probably benign 0.01
R6181:Tdrd6 UTSW 17 43628897 missense probably damaging 1.00
R6195:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6233:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6289:Tdrd6 UTSW 17 43624520 missense probably benign 0.01
R6315:Tdrd6 UTSW 17 43626338 missense probably benign 0.02
R6578:Tdrd6 UTSW 17 43628961 missense possibly damaging 0.65
R6645:Tdrd6 UTSW 17 43624532 missense probably benign 0.10
R6822:Tdrd6 UTSW 17 43627215 missense probably damaging 1.00
R7000:Tdrd6 UTSW 17 43627708 missense probably benign 0.28
R7075:Tdrd6 UTSW 17 43625174 missense probably benign 0.10
R7107:Tdrd6 UTSW 17 43624204 missense probably benign 0.00
R7381:Tdrd6 UTSW 17 43626093 missense probably benign 0.00
R7458:Tdrd6 UTSW 17 43625046 missense probably benign 0.02
R7461:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7505:Tdrd6 UTSW 17 43627679 missense not run
R7583:Tdrd6 UTSW 17 43624238 missense probably benign 0.29
R7613:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7723:Tdrd6 UTSW 17 43625960 missense probably benign 0.09
R7759:Tdrd6 UTSW 17 43624839 missense probably benign 0.00
R7924:Tdrd6 UTSW 17 43627806 missense possibly damaging 0.94
R8002:Tdrd6 UTSW 17 43629819 missense probably damaging 0.98
R8134:Tdrd6 UTSW 17 43626173 missense probably damaging 0.99
R8231:Tdrd6 UTSW 17 43622135 missense probably damaging 1.00
R8242:Tdrd6 UTSW 17 43628930 missense probably damaging 1.00
R8542:Tdrd6 UTSW 17 43624892 missense probably damaging 1.00
R8713:Tdrd6 UTSW 17 43625019 missense not run
X0065:Tdrd6 UTSW 17 43625153 missense possibly damaging 0.80
X0065:Tdrd6 UTSW 17 43625993 missense probably damaging 0.99
Z1088:Tdrd6 UTSW 17 43626518 missense probably benign 0.23
Z1177:Tdrd6 UTSW 17 43627187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCATCTGCGAGGATCACTTC -3'
(R):5'- TGAGATCAACAACCTCTCAGAGAG -3'

Sequencing Primer
(F):5'- CCAGGTGCCTTGGAATTTAAC -3'
(R):5'- GACTAAATGATGTCAGAACACGGCC -3'
Posted On2015-06-12