Incidental Mutation 'R4226:Tmem236'
ID320028
Institutional Source Beutler Lab
Gene Symbol Tmem236
Ensembl Gene ENSMUSG00000061531
Gene Nametransmembrane protein 236
SynonymsFam23a, 2010003H20Rik
MMRRC Submission 041046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4226 (G1)
Quality Score96
Status Not validated
Chromosome2
Chromosomal Location14174523-14221993 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 14174626 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 13 (E13*)
Ref Sequence ENSEMBL: ENSMUSP00000076722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077517]
Predicted Effect probably null
Transcript: ENSMUST00000077517
AA Change: E13*
SMART Domains Protein: ENSMUSP00000076722
Gene: ENSMUSG00000061531
AA Change: E13*

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
low complexity region 119 143 N/A INTRINSIC
transmembrane domain 256 275 N/A INTRINSIC
transmembrane domain 295 314 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,880 V279E possibly damaging Het
Ache T C 5: 137,290,890 V286A possibly damaging Het
Amotl1 T C 9: 14,593,678 N115S probably benign Het
Aoah A T 13: 20,979,526 Y333F possibly damaging Het
Ap4m1 A T 5: 138,172,817 R74* probably null Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ccdc146 T A 5: 21,322,758 I187L probably benign Het
Cfh A T 1: 140,108,926 C360S probably damaging Het
Csmd1 T C 8: 16,000,490 N2249D probably damaging Het
Cyb5r4 T G 9: 87,057,229 I355S probably damaging Het
Dnm1l A T 16: 16,314,387 H653Q possibly damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gm16503 C T 4: 147,541,268 S73L unknown Het
Hnrnpll A T 17: 80,049,805 probably null Het
Igf1r T A 7: 68,195,078 Y866* probably null Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Mc1r A G 8: 123,407,856 N116S possibly damaging Het
Micu2 T C 14: 57,932,285 K203E possibly damaging Het
Mybpc1 C T 10: 88,573,525 W36* probably null Het
Nsd1 C T 13: 55,260,401 T1286I probably damaging Het
Olfr444 A G 6: 42,955,755 T86A probably benign Het
Olfr606 T C 7: 103,451,577 M80T probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Ryr1 A C 7: 29,062,151 Y3190* probably null Het
Sec31b T A 19: 44,531,710 M212L probably benign Het
Smc4 A G 3: 69,031,467 E950G probably benign Het
Tlr1 A T 5: 64,925,717 S506T probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn1r39 T C 6: 66,804,719 H205R possibly damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zan T C 5: 137,423,978 N2793D unknown Het
Other mutations in Tmem236
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Tmem236 APN 2 14219378 missense probably damaging 1.00
IGL01363:Tmem236 APN 2 14174630 missense probably damaging 1.00
IGL01980:Tmem236 APN 2 14218905 missense probably benign 0.16
IGL02749:Tmem236 APN 2 14219321 missense probably damaging 1.00
R0172:Tmem236 UTSW 2 14218883 missense probably benign 0.06
R1470:Tmem236 UTSW 2 14218921 missense probably benign 0.22
R1470:Tmem236 UTSW 2 14218921 missense probably benign 0.22
R1519:Tmem236 UTSW 2 14192280 missense probably benign 0.00
R1923:Tmem236 UTSW 2 14219306 missense probably damaging 1.00
R2147:Tmem236 UTSW 2 14219050 missense probably benign 0.03
R4551:Tmem236 UTSW 2 14219153 missense probably benign 0.02
R4904:Tmem236 UTSW 2 14195992 missense probably benign
R5168:Tmem236 UTSW 2 14192328 critical splice donor site probably null
R5283:Tmem236 UTSW 2 14174833 missense probably benign 0.01
R5306:Tmem236 UTSW 2 14219164 nonsense probably null
R5334:Tmem236 UTSW 2 14219060 missense possibly damaging 0.85
R6516:Tmem236 UTSW 2 14195980 missense probably benign 0.00
R6604:Tmem236 UTSW 2 14174701 missense probably benign 0.03
R7689:Tmem236 UTSW 2 14192265 missense probably damaging 0.99
X0062:Tmem236 UTSW 2 14219278 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTAGTCACTTCTACAGAGGTTCTG -3'
(R):5'- GGACAACTTTTACCGGAACCC -3'

Sequencing Primer
(F):5'- CAGATCATTGAACCATATGAGGGTC -3'
(R):5'- TTTTACCGGAACCCAAATCAAGAG -3'
Posted On2015-06-12