Incidental Mutation 'R4226:Vmn1r39'
ID320039
Institutional Source Beutler Lab
Gene Symbol Vmn1r39
Ensembl Gene ENSMUSG00000093755
Gene Namevomeronasal 1 receptor 39
SynonymsGm5993
MMRRC Submission 041046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4226 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location66803297-66810609 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66804719 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 205 (H205R)
Ref Sequence ENSEMBL: ENSMUSP00000153741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089918] [ENSMUST00000226217] [ENSMUST00000226783] [ENSMUST00000227285] [ENSMUST00000227555] [ENSMUST00000228008] [ENSMUST00000228651] [ENSMUST00000228862] [ENSMUST00000228919]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089918
AA Change: H205R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087364
Gene: ENSMUSG00000093755
AA Change: H205R

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.5e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226217
AA Change: H205R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226783
AA Change: H205R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227285
AA Change: H168R

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227555
AA Change: H205R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228008
AA Change: H168R

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228651
AA Change: H168R

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228862
AA Change: H205R

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228919
AA Change: H168R

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,880 V279E possibly damaging Het
Ache T C 5: 137,290,890 V286A possibly damaging Het
Amotl1 T C 9: 14,593,678 N115S probably benign Het
Aoah A T 13: 20,979,526 Y333F possibly damaging Het
Ap4m1 A T 5: 138,172,817 R74* probably null Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ccdc146 T A 5: 21,322,758 I187L probably benign Het
Cfh A T 1: 140,108,926 C360S probably damaging Het
Csmd1 T C 8: 16,000,490 N2249D probably damaging Het
Cyb5r4 T G 9: 87,057,229 I355S probably damaging Het
Dnm1l A T 16: 16,314,387 H653Q possibly damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gm16503 C T 4: 147,541,268 S73L unknown Het
Hnrnpll A T 17: 80,049,805 probably null Het
Igf1r T A 7: 68,195,078 Y866* probably null Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Mc1r A G 8: 123,407,856 N116S possibly damaging Het
Micu2 T C 14: 57,932,285 K203E possibly damaging Het
Mybpc1 C T 10: 88,573,525 W36* probably null Het
Nsd1 C T 13: 55,260,401 T1286I probably damaging Het
Olfr444 A G 6: 42,955,755 T86A probably benign Het
Olfr606 T C 7: 103,451,577 M80T probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Ryr1 A C 7: 29,062,151 Y3190* probably null Het
Sec31b T A 19: 44,531,710 M212L probably benign Het
Smc4 A G 3: 69,031,467 E950G probably benign Het
Tlr1 A T 5: 64,925,717 S506T probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem236 G T 2: 14,174,626 E13* probably null Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zan T C 5: 137,423,978 N2793D unknown Het
Other mutations in Vmn1r39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02428:Vmn1r39 APN 6 66804962 missense probably benign 0.05
R0189:Vmn1r39 UTSW 6 66805197 missense probably benign 0.10
R1132:Vmn1r39 UTSW 6 66804444 missense probably benign
R1803:Vmn1r39 UTSW 6 66804911 missense probably benign 0.00
R1839:Vmn1r39 UTSW 6 66805233 critical splice acceptor site probably null
R2966:Vmn1r39 UTSW 6 66804731 missense possibly damaging 0.94
R3747:Vmn1r39 UTSW 6 66804870 missense probably benign 0.03
R3748:Vmn1r39 UTSW 6 66804870 missense probably benign 0.03
R3756:Vmn1r39 UTSW 6 66804879 missense probably damaging 0.97
R3905:Vmn1r39 UTSW 6 66804495 nonsense probably null
R3912:Vmn1r39 UTSW 6 66805141 missense probably benign
R4426:Vmn1r39 UTSW 6 66805361 unclassified probably null
R5493:Vmn1r39 UTSW 6 66804770 missense probably damaging 0.97
R6498:Vmn1r39 UTSW 6 66804857 missense probably damaging 1.00
R6944:Vmn1r39 UTSW 6 66805221 start codon destroyed probably null 0.00
R7592:Vmn1r39 UTSW 6 66804444 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATTTAGCACAAACTTCTGAACAG -3'
(R):5'- AGGCTGTGATGATCAGTCCC -3'

Sequencing Primer
(F):5'- TTAGCACAAACTTCTGAACAGTCAAC -3'
(R):5'- GGCTGTGATGATCAGTCCCAATAC -3'
Posted On2015-06-12