Incidental Mutation 'R4226:Igf1r'
ID320041
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Nameinsulin-like growth factor I receptor
Synonymsline 186, A330103N21Rik, CD221, hyft, IGF-1R
MMRRC Submission 041046-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4226 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location67952827-68233668 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 68195078 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 866 (Y866*)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
Predicted Effect probably null
Transcript: ENSMUST00000005671
AA Change: Y866*
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: Y866*

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208348
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,880 V279E possibly damaging Het
Ache T C 5: 137,290,890 V286A possibly damaging Het
Amotl1 T C 9: 14,593,678 N115S probably benign Het
Aoah A T 13: 20,979,526 Y333F possibly damaging Het
Ap4m1 A T 5: 138,172,817 R74* probably null Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ccdc146 T A 5: 21,322,758 I187L probably benign Het
Cfh A T 1: 140,108,926 C360S probably damaging Het
Csmd1 T C 8: 16,000,490 N2249D probably damaging Het
Cyb5r4 T G 9: 87,057,229 I355S probably damaging Het
Dnm1l A T 16: 16,314,387 H653Q possibly damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gm16503 C T 4: 147,541,268 S73L unknown Het
Hnrnpll A T 17: 80,049,805 probably null Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Mc1r A G 8: 123,407,856 N116S possibly damaging Het
Micu2 T C 14: 57,932,285 K203E possibly damaging Het
Mybpc1 C T 10: 88,573,525 W36* probably null Het
Nsd1 C T 13: 55,260,401 T1286I probably damaging Het
Olfr444 A G 6: 42,955,755 T86A probably benign Het
Olfr606 T C 7: 103,451,577 M80T probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Ryr1 A C 7: 29,062,151 Y3190* probably null Het
Sec31b T A 19: 44,531,710 M212L probably benign Het
Smc4 A G 3: 69,031,467 E950G probably benign Het
Tlr1 A T 5: 64,925,717 S506T probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem236 G T 2: 14,174,626 E13* probably null Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn1r39 T C 6: 66,804,719 H205R possibly damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zan T C 5: 137,423,978 N2793D unknown Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense not run
BB019:Igf1r UTSW 7 68212054 missense not run
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7373:Igf1r UTSW 7 68195078 nonsense probably null
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7986:Igf1r UTSW 7 68184752 missense probably damaging 1.00
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CAGTTGTTCTCAAGTTAGCACACC -3'
(R):5'- GCTCCATGCACCCAAGTTAC -3'

Sequencing Primer
(F):5'- CAAGTTAGCACACCGTTTATCATTC -3'
(R):5'- CTACTCAATAAAGATGGCGTTGC -3'
Posted On2015-06-12