Incidental Mutation 'R4226:Micu2'
ID320053
Institutional Source Beutler Lab
Gene Symbol Micu2
Ensembl Gene ENSMUSG00000021973
Gene Namemitochondrial calcium uptake 2
Synonyms4833427E09Rik, 1110008L20Rik, Efha1
MMRRC Submission 041046-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4226 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location57916261-57999262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57932285 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 203 (K203E)
Ref Sequence ENSEMBL: ENSMUSP00000022543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022543
AA Change: K203E

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022543
Gene: ENSMUSG00000021973
AA Change: K203E

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 35 50 N/A INTRINSIC
EFh 173 201 1.15e0 SMART
EFh 363 391 1.12e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224984
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit an enlarged heart left atrium along with delayed calcium reuptake and decreased relaxation rates by cardiomyocytes, and develop abdominal aortic aneurysms with spontaneous rupture following angiotensin II treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,880 V279E possibly damaging Het
Ache T C 5: 137,290,890 V286A possibly damaging Het
Amotl1 T C 9: 14,593,678 N115S probably benign Het
Aoah A T 13: 20,979,526 Y333F possibly damaging Het
Ap4m1 A T 5: 138,172,817 R74* probably null Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ccdc146 T A 5: 21,322,758 I187L probably benign Het
Cfh A T 1: 140,108,926 C360S probably damaging Het
Csmd1 T C 8: 16,000,490 N2249D probably damaging Het
Cyb5r4 T G 9: 87,057,229 I355S probably damaging Het
Dnm1l A T 16: 16,314,387 H653Q possibly damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gm16503 C T 4: 147,541,268 S73L unknown Het
Hnrnpll A T 17: 80,049,805 probably null Het
Igf1r T A 7: 68,195,078 Y866* probably null Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Mc1r A G 8: 123,407,856 N116S possibly damaging Het
Mybpc1 C T 10: 88,573,525 W36* probably null Het
Nsd1 C T 13: 55,260,401 T1286I probably damaging Het
Olfr444 A G 6: 42,955,755 T86A probably benign Het
Olfr606 T C 7: 103,451,577 M80T probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Ryr1 A C 7: 29,062,151 Y3190* probably null Het
Sec31b T A 19: 44,531,710 M212L probably benign Het
Smc4 A G 3: 69,031,467 E950G probably benign Het
Tlr1 A T 5: 64,925,717 S506T probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem236 G T 2: 14,174,626 E13* probably null Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn1r39 T C 6: 66,804,719 H205R possibly damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zan T C 5: 137,423,978 N2793D unknown Het
Other mutations in Micu2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Micu2 APN 14 57943625 missense probably damaging 1.00
IGL02416:Micu2 APN 14 57923965 missense probably damaging 0.99
IGL02675:Micu2 APN 14 57945377 splice site probably benign
IGL03343:Micu2 APN 14 57917311 missense probably benign 0.01
ANU22:Micu2 UTSW 14 57943625 missense probably damaging 1.00
R0238:Micu2 UTSW 14 57917378 splice site probably benign
R0239:Micu2 UTSW 14 57917378 splice site probably benign
R0488:Micu2 UTSW 14 57932242 missense probably benign 0.00
R0564:Micu2 UTSW 14 57919374 missense possibly damaging 0.82
R1116:Micu2 UTSW 14 57954200 missense probably benign 0.00
R1471:Micu2 UTSW 14 57945397 missense probably damaging 0.99
R2011:Micu2 UTSW 14 57954133 splice site probably null
R5595:Micu2 UTSW 14 57971744 missense probably damaging 1.00
R6583:Micu2 UTSW 14 57943670 missense probably damaging 0.99
R6800:Micu2 UTSW 14 57919439 missense possibly damaging 0.89
R7125:Micu2 UTSW 14 57971781 nonsense probably null
R7205:Micu2 UTSW 14 57954149 missense probably benign 0.42
R7383:Micu2 UTSW 14 57917353 missense possibly damaging 0.63
R7852:Micu2 UTSW 14 57932253 missense probably benign
R7935:Micu2 UTSW 14 57932253 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATCTGCATGTGCCTTTGTAG -3'
(R):5'- AGACTTTAGAGCCTGGCTGTTG -3'

Sequencing Primer
(F):5'- AGCTTAGTAAGTGTGCGCCAG -3'
(R):5'- TGCTGAGCAGGAGACTCG -3'
Posted On2015-06-12