Incidental Mutation 'R4226:Dnm1l'
ID320056
Institutional Source Beutler Lab
Gene Symbol Dnm1l
Ensembl Gene ENSMUSG00000022789
Gene Namedynamin 1-like
Synonyms6330417M19Rik, python, Dnmlp1, Drp1
MMRRC Submission 041046-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4226 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16312230-16358959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16314387 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 653 (H653Q)
Ref Sequence ENSEMBL: ENSMUSP00000093945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023477] [ENSMUST00000059955] [ENSMUST00000096229] [ENSMUST00000115749] [ENSMUST00000159683] [ENSMUST00000230022] [ENSMUST00000230980]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023477
AA Change: H640Q

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023477
Gene: ENSMUSG00000022789
AA Change: H640Q

DomainStartEndE-ValueType
DYNc 1 255 9.83e-124 SMART
low complexity region 556 571 N/A INTRINSIC
GED 602 693 2.52e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059955
SMART Domains Protein: ENSMUSP00000055277
Gene: ENSMUSG00000022792

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 370 5.9e-74 PFAM
Blast:S4 403 466 1e-10 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000096229
AA Change: H653Q

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093945
Gene: ENSMUSG00000022789
AA Change: H653Q

DomainStartEndE-ValueType
DYNc 1 268 1.75e-120 SMART
low complexity region 569 584 N/A INTRINSIC
GED 615 706 2.52e-45 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115749
AA Change: H528Q

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111415
Gene: ENSMUSG00000022789
AA Change: H528Q

DomainStartEndE-ValueType
DYNc 1 261 2.08e-122 SMART
low complexity region 573 588 N/A INTRINSIC
GED 619 710 2.52e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159683
SMART Domains Protein: ENSMUSP00000124606
Gene: ENSMUSG00000022792

DomainStartEndE-ValueType
Pfam:tRNA-synt_1b 64 332 1.4e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230022
AA Change: H553Q

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230958
Predicted Effect possibly damaging
Transcript: ENSMUST00000230980
AA Change: H657Q

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the dynamin family. The encoded protein is localized to the cytoplasm and mitochondrial membrane, is involved in mitochondrial and peroxisomal division, and is essential for mitochondrial fission. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality at E11.5 with internal hemorrhage and small size. Mice heterozygous for an ENU induced allele have dilated cardiomyopathy and congestive heart failure, homozygous are embryonic lethal with posterior truncation at E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,880 V279E possibly damaging Het
Ache T C 5: 137,290,890 V286A possibly damaging Het
Amotl1 T C 9: 14,593,678 N115S probably benign Het
Aoah A T 13: 20,979,526 Y333F possibly damaging Het
Ap4m1 A T 5: 138,172,817 R74* probably null Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ccdc146 T A 5: 21,322,758 I187L probably benign Het
Cfh A T 1: 140,108,926 C360S probably damaging Het
Csmd1 T C 8: 16,000,490 N2249D probably damaging Het
Cyb5r4 T G 9: 87,057,229 I355S probably damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gm16503 C T 4: 147,541,268 S73L unknown Het
Hnrnpll A T 17: 80,049,805 probably null Het
Igf1r T A 7: 68,195,078 Y866* probably null Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Mc1r A G 8: 123,407,856 N116S possibly damaging Het
Micu2 T C 14: 57,932,285 K203E possibly damaging Het
Mybpc1 C T 10: 88,573,525 W36* probably null Het
Nsd1 C T 13: 55,260,401 T1286I probably damaging Het
Olfr444 A G 6: 42,955,755 T86A probably benign Het
Olfr606 T C 7: 103,451,577 M80T probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Ryr1 A C 7: 29,062,151 Y3190* probably null Het
Sec31b T A 19: 44,531,710 M212L probably benign Het
Smc4 A G 3: 69,031,467 E950G probably benign Het
Tlr1 A T 5: 64,925,717 S506T probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem236 G T 2: 14,174,626 E13* probably null Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn1r39 T C 6: 66,804,719 H205R possibly damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zan T C 5: 137,423,978 N2793D unknown Het
Other mutations in Dnm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Dnm1l APN 16 16333827 critical splice donor site probably null
IGL00696:Dnm1l APN 16 16342715 missense probably benign
IGL01146:Dnm1l APN 16 16314325 missense probably benign 0.01
IGL01385:Dnm1l APN 16 16341453 missense probably damaging 1.00
IGL01694:Dnm1l APN 16 16316651 missense probably benign 0.08
IGL02250:Dnm1l APN 16 16321686 splice site probably benign
IGL02335:Dnm1l APN 16 16342740 intron probably benign
IGL02345:Dnm1l APN 16 16329894 missense possibly damaging 0.61
IGL02403:Dnm1l APN 16 16336976 missense possibly damaging 0.78
IGL02684:Dnm1l APN 16 16321657 missense possibly damaging 0.95
IGL02869:Dnm1l APN 16 16341424 nonsense probably null
IGL03388:Dnm1l APN 16 16314052 splice site probably benign
R0068:Dnm1l UTSW 16 16324019 missense probably damaging 1.00
R0068:Dnm1l UTSW 16 16324019 missense probably damaging 1.00
R1259:Dnm1l UTSW 16 16324006 missense possibly damaging 0.67
R1554:Dnm1l UTSW 16 16341426 missense probably benign 0.13
R1756:Dnm1l UTSW 16 16342695 critical splice donor site probably null
R1913:Dnm1l UTSW 16 16329966 missense probably benign 0.45
R2906:Dnm1l UTSW 16 16314311 missense probably damaging 0.96
R2907:Dnm1l UTSW 16 16314311 missense probably damaging 0.96
R3756:Dnm1l UTSW 16 16321612 missense possibly damaging 0.86
R4414:Dnm1l UTSW 16 16342695 critical splice donor site probably null
R5287:Dnm1l UTSW 16 16333868 missense probably damaging 1.00
R5574:Dnm1l UTSW 16 16329821 missense probably damaging 1.00
R5653:Dnm1l UTSW 16 16319489 missense probably damaging 1.00
R6113:Dnm1l UTSW 16 16341003 missense probably benign 0.00
R6320:Dnm1l UTSW 16 16332088 missense probably damaging 1.00
R6644:Dnm1l UTSW 16 16329873 missense probably benign 0.14
R6995:Dnm1l UTSW 16 16329807 nonsense probably null
R7309:Dnm1l UTSW 16 16321646 missense probably damaging 1.00
R7422:Dnm1l UTSW 16 16318474 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGTGTACATCCCAGGGAGAAAG -3'
(R):5'- CAAGGATTTTGACTTTGCTTATTGC -3'

Sequencing Primer
(F):5'- AGATTGAGAACAATTTCACAGTTACC -3'
(R):5'- ACTTTGTTTGGACCCATTATCACAG -3'
Posted On2015-06-12