Incidental Mutation 'R4226:Capn11'
ID320058
Institutional Source Beutler Lab
Gene Symbol Capn11
Ensembl Gene ENSMUSG00000058626
Gene Namecalpain 11
Synonyms
MMRRC Submission 041046-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4226 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location45630204-45659325 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 45642466 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120717] [ENSMUST00000151350]
Predicted Effect probably null
Transcript: ENSMUST00000120717
SMART Domains Protein: ENSMUSP00000113132
Gene: ENSMUSG00000058626

DomainStartEndE-ValueType
CysPc 37 362 2.75e-157 SMART
calpain_III 366 523 2.57e-84 SMART
EFh 590 618 3.91e-4 SMART
EFh 620 648 6.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151350
SMART Domains Protein: ENSMUSP00000119679
Gene: ENSMUSG00000058626

DomainStartEndE-ValueType
Pfam:Peptidase_C2 94 153 1.5e-14 PFAM
low complexity region 163 174 N/A INTRINSIC
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains constitute a family of intracellular calcium-dependent cysteine proteases. There are eight members in this superfamily. They consist of a variable 80 kDa subunit and an invariant 30 kDa subunit. This calpain protein appears to have protease activity and calcium-binding ability. A similar mouse protein may play a functional role in spermatogenesis and in the regulation of calcium-dependent signal transduction events during meiosis. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik T A 5: 146,504,880 V279E possibly damaging Het
Ache T C 5: 137,290,890 V286A possibly damaging Het
Amotl1 T C 9: 14,593,678 N115S probably benign Het
Aoah A T 13: 20,979,526 Y333F possibly damaging Het
Ap4m1 A T 5: 138,172,817 R74* probably null Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Ccdc146 T A 5: 21,322,758 I187L probably benign Het
Cfh A T 1: 140,108,926 C360S probably damaging Het
Csmd1 T C 8: 16,000,490 N2249D probably damaging Het
Cyb5r4 T G 9: 87,057,229 I355S probably damaging Het
Dnm1l A T 16: 16,314,387 H653Q possibly damaging Het
Frmd4a C T 2: 4,333,078 R32C probably benign Het
Gm16503 C T 4: 147,541,268 S73L unknown Het
Hnrnpll A T 17: 80,049,805 probably null Het
Igf1r T A 7: 68,195,078 Y866* probably null Het
Lct T C 1: 128,304,226 M629V probably damaging Het
Mc1r A G 8: 123,407,856 N116S possibly damaging Het
Micu2 T C 14: 57,932,285 K203E possibly damaging Het
Mybpc1 C T 10: 88,573,525 W36* probably null Het
Nsd1 C T 13: 55,260,401 T1286I probably damaging Het
Olfr444 A G 6: 42,955,755 T86A probably benign Het
Olfr606 T C 7: 103,451,577 M80T probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Ryr1 A C 7: 29,062,151 Y3190* probably null Het
Sec31b T A 19: 44,531,710 M212L probably benign Het
Smc4 A G 3: 69,031,467 E950G probably benign Het
Tlr1 A T 5: 64,925,717 S506T probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmem236 G T 2: 14,174,626 E13* probably null Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn1r39 T C 6: 66,804,719 H205R possibly damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zan T C 5: 137,423,978 N2793D unknown Het
Other mutations in Capn11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Capn11 APN 17 45643767 missense probably damaging 1.00
IGL01116:Capn11 APN 17 45638880 unclassified probably benign
IGL01121:Capn11 APN 17 45639132 missense probably benign 0.04
IGL01366:Capn11 APN 17 45653200 missense probably damaging 1.00
IGL01533:Capn11 APN 17 45632904 missense probably benign
IGL01595:Capn11 APN 17 45639434 missense probably benign 0.02
IGL02197:Capn11 APN 17 45639856 missense probably benign 0.14
IGL02683:Capn11 APN 17 45653591 missense probably damaging 1.00
IGL02696:Capn11 APN 17 45632709 missense probably damaging 1.00
IGL02711:Capn11 APN 17 45632415 missense probably damaging 1.00
IGL02900:Capn11 APN 17 45630614 splice site probably null
IGL03033:Capn11 APN 17 45642547 missense probably damaging 1.00
R0883:Capn11 UTSW 17 45638881 unclassified probably benign
R1494:Capn11 UTSW 17 45643809 missense probably damaging 1.00
R1735:Capn11 UTSW 17 45632401 nonsense probably null
R1785:Capn11 UTSW 17 45638697 missense probably benign 0.02
R1952:Capn11 UTSW 17 45642959 missense probably damaging 1.00
R2149:Capn11 UTSW 17 45633107 critical splice acceptor site probably null
R2397:Capn11 UTSW 17 45653221 missense probably damaging 1.00
R2495:Capn11 UTSW 17 45638763 missense probably damaging 0.97
R2516:Capn11 UTSW 17 45633799 missense probably damaging 0.98
R3934:Capn11 UTSW 17 45634287 splice site probably benign
R4016:Capn11 UTSW 17 45653756 missense probably damaging 1.00
R4227:Capn11 UTSW 17 45642466 critical splice donor site probably null
R4774:Capn11 UTSW 17 45633080 missense probably benign 0.00
R4892:Capn11 UTSW 17 45633097 frame shift probably null
R5244:Capn11 UTSW 17 45633892 missense probably damaging 1.00
R5667:Capn11 UTSW 17 45639674 missense possibly damaging 0.87
R5671:Capn11 UTSW 17 45639674 missense possibly damaging 0.87
R5991:Capn11 UTSW 17 45659352 unclassified probably null
R6180:Capn11 UTSW 17 45630766 missense probably damaging 1.00
R6193:Capn11 UTSW 17 45653504 critical splice donor site probably null
R6774:Capn11 UTSW 17 45657330 intron probably benign
R7047:Capn11 UTSW 17 45638696 nonsense probably null
R7302:Capn11 UTSW 17 45643812 missense probably damaging 1.00
R7516:Capn11 UTSW 17 45638840 missense possibly damaging 0.95
R7563:Capn11 UTSW 17 45633965 missense probably damaging 0.99
R7718:Capn11 UTSW 17 45643781 missense probably damaging 1.00
R7999:Capn11 UTSW 17 45639206 missense probably damaging 1.00
R8058:Capn11 UTSW 17 45643755 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCATTATGAGTTACTAAGGGGTCAC -3'
(R):5'- TGACATCTCCTAACAGCGCC -3'

Sequencing Primer
(F):5'- TGAGTTACTAAGGGGTCACAGAAAG -3'
(R):5'- AACAGCGCCCTATCTGCCTG -3'
Posted On2015-06-12