Mutagenetix > Incidental Mutation

Incidental Mutation 'R0396:Sptan1'

32006

Institutional Source

Beutler Lab

Gene Symbol

Sptan1

Ensembl Gene

ENSMUSG00000057738

Gene Name

spectrin alpha, non-erythrocytic 1

Synonyms

alpha-fodrin, Spna2, 2610027H02Rik, Spna-2

MMRRC Submission

038602-MU

Accession Numbers

Ncbi RefSeq: NM_001076554.2, NM_001177667.1, NM_001177668.1; MGI:98386

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0396 (G1)

Quality Score

179

Status

Validated

Chromosome

Chromosomal Location

29965560-30031451 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29991033 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 438 (V438A)

Ref Sequence

ENSEMBL: ENSMUSP00000109348 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]

AlphaFold

P16546

Predicted Effect

probably damaging
Transcript: ENSMUST00000046257
AA Change: V438A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: V438A

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1635	9.65e-30	SMART
SPEC	1641	1741	2.32e-32	SMART
SPEC	1747	1847	6.98e-36	SMART
SPEC	1853	1953	1.53e-32	SMART
SPEC	1959	2060	6.23e-24	SMART
SPEC	2074	2174	2.08e-11	SMART
SPEC	2188	2289	1.07e-4	SMART
EFh	2307	2335	5.78e-7	SMART
EFh	2350	2378	3.85e-3	SMART
efhand_Ca_insen	2382	2451	6.74e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000095083
AA Change: V438A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: V438A

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1088	1.56e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1094	1230	6.52e-27	SMART
SPEC	1236	1336	1.44e-37	SMART
SPEC	1342	1442	4.43e-29	SMART
SPEC	1448	1548	7.54e-32	SMART
SPEC	1554	1655	9.65e-30	SMART
SPEC	1661	1761	2.32e-32	SMART
SPEC	1767	1867	6.98e-36	SMART
SPEC	1873	1973	1.53e-32	SMART
SPEC	1979	2080	6.23e-24	SMART
SPEC	2094	2194	2.08e-11	SMART
SPEC	2208	2309	1.07e-4	SMART
EFh	2327	2355	5.78e-7	SMART
EFh	2370	2398	3.85e-3	SMART
efhand_Ca_insen	2402	2471	6.74e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100225
AA Change: V438A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: V438A

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1088	1.56e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1094	1230	6.52e-27	SMART
SPEC	1236	1336	1.44e-37	SMART
SPEC	1342	1442	4.43e-29	SMART
SPEC	1448	1548	7.54e-32	SMART
SPEC	1554	1660	2.06e-24	SMART
SPEC	1666	1766	2.32e-32	SMART
SPEC	1772	1872	6.98e-36	SMART
SPEC	1878	1978	1.53e-32	SMART
SPEC	1984	2085	6.23e-24	SMART
SPEC	2099	2199	2.08e-11	SMART
SPEC	2213	2314	1.07e-4	SMART
EFh	2332	2360	5.78e-7	SMART
EFh	2375	2403	3.85e-3	SMART
efhand_Ca_insen	2407	2476	6.74e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113717
AA Change: V438A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: V438A

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1640	2.06e-24	SMART
SPEC	1646	1746	2.32e-32	SMART
SPEC	1752	1852	6.98e-36	SMART
SPEC	1858	1958	1.53e-32	SMART
SPEC	1964	2065	6.23e-24	SMART
SPEC	2079	2179	2.08e-11	SMART
SPEC	2193	2294	1.07e-4	SMART
EFh	2312	2340	5.78e-7	SMART
EFh	2355	2383	3.85e-3	SMART
efhand_Ca_insen	2387	2456	6.74e-32	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113719
AA Change: V438A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: V438A

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1640	2.06e-24	SMART
SPEC	1646	1746	2.32e-32	SMART
SPEC	1752	1852	6.98e-36	SMART
SPEC	1858	1958	1.53e-32	SMART
SPEC	1964	2065	6.23e-24	SMART
SPEC	2079	2179	2.08e-11	SMART
SPEC	2193	2315	3.27e0	SMART
EFh	2333	2361	5.78e-7	SMART
EFh	2376	2404	3.85e-3	SMART
efhand_Ca_insen	2408	2477	6.74e-32	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000129241
AA Change: V438A

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: V438A

Domain	Start	End	E-Value	Type
Pfam:Spectrin	1	65	9.9e-10	PFAM
SPEC	78	178	2.08e-11	SMART
SPEC	192	314	3.27e0	SMART
EFh	332	360	5.78e-7	SMART
EFh	375	403	3.85e-3	SMART
efhand_Ca_insen	407	476	6.74e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131827

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143918

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184313

Meta Mutation Damage Score

0.4987

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 89.8%

Validation Efficiency

92% (96/104)

MGI Phenotype

Strain: 3714925; 4330132
Lethality: E12-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]

Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,268,377	V467A	possibly damaging	Het
4933405L10Rik	G	A	8: 105,709,780	V194I	probably benign	Het
Acsm1	A	T	7: 119,636,455	I133F	probably damaging	Het
Adamts9	T	A	6: 92,798,005	T1676S	probably benign	Het
Adcy4	T	C	14: 55,772,288	D769G	probably benign	Het
Aif1	T	C	17: 35,171,109	*148W	probably null	Het
Akna	C	T	4: 63,392,126		probably benign	Het
Arhgap32	G	A	9: 32,245,255		probably null	Het
Atpaf1	G	A	4: 115,785,252	E92K	possibly damaging	Het
C1s1	T	C	6: 124,533,354	E378G	probably benign	Het
Caprin1	T	A	2: 103,769,569	Q108L	probably damaging	Het
Car13	A	T	3: 14,656,239	H154L	probably benign	Het
Cdon	C	A	9: 35,470,130	N605K	probably damaging	Het
Ceacam10	G	A	7: 24,781,014	G70E	probably damaging	Het
Cfap221	G	A	1: 119,954,200	T286M	probably benign	Het
Cfap61	T	C	2: 145,949,944	F107S	possibly damaging	Het
Coil	C	A	11: 88,981,623	T270N	probably benign	Het
Crocc2	T	G	1: 93,224,214		probably benign	Het
Crot	T	C	5: 8,969,959	E461G	probably damaging	Het
D130052B06Rik	G	T	11: 33,623,391	R41L	unknown	Het
D630045J12Rik	T	C	6: 38,196,736	S166G	possibly damaging	Het
Dennd4a	T	G	9: 64,862,391	V460G	probably damaging	Het
Depdc7	A	T	2: 104,727,323		probably benign	Het
Dgkb	G	A	12: 38,190,135		probably null	Het
Dhx57	T	G	17: 80,274,797	S407R	probably benign	Het
Dnase2a	G	T	8: 84,909,763		probably benign	Het
Dqx1	T	G	6: 83,059,005	M106R	probably benign	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Ephx2	T	G	14: 66,108,063	I151L	probably benign	Het
Gdf3	C	T	6: 122,607,135	G91D	probably damaging	Het
Gm14124	G	A	2: 150,268,053	G221D	probably damaging	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gsdme	T	A	6: 50,221,107	H291L	probably benign	Het
H2-Bl	A	G	17: 36,083,722	I103T	possibly damaging	Het
Hif3a	G	A	7: 17,052,021		probably benign	Het
Hmox2	A	T	16: 4,765,763	I232L	probably benign	Het
Itgb2	A	G	10: 77,561,189	Y686C	probably damaging	Het
Jmjd1c	A	G	10: 67,219,523	T528A	possibly damaging	Het
Kdr	T	C	5: 75,960,728	I541V	possibly damaging	Het
Khdrbs2	C	A	1: 32,519,973	V343L	probably damaging	Het
Kif16b	C	T	2: 142,853,659	R175H	probably damaging	Het
Klri2	T	G	6: 129,740,288	E44A	possibly damaging	Het
Kmt2b	G	T	7: 30,576,755	T1773K	probably damaging	Het
Lair1	A	G	7: 4,010,786	L154P	probably damaging	Het
Larp1b	G	A	3: 40,970,561	V158M	probably damaging	Het
Lgi3	T	A	14: 70,534,840	I275N	probably damaging	Het
Lrba	A	G	3: 86,295,179	N246D	probably damaging	Het
Lrrc45	T	A	11: 120,714,907		probably benign	Het
Mdh2	G	T	5: 135,789,679	V263L	probably benign	Het
Myom1	T	A	17: 71,034,693	V149E	probably damaging	Het
Nanos1	A	T	19: 60,757,041	D259V	probably damaging	Het
Nedd4l	T	A	18: 65,161,654		probably benign	Het
Npas3	A	G	12: 53,831,745	Y150C	probably damaging	Het
Olfr1066	T	C	2: 86,456,019	N84S	possibly damaging	Het
Olfr1129	T	A	2: 87,575,567	V161D	possibly damaging	Het
Olfr1392	A	T	11: 49,293,338	I6F	probably benign	Het
Olfr479	A	T	7: 108,055,963	H327L	probably benign	Het
Olfr672	G	A	7: 104,996,706	A66V	probably damaging	Het
Olfr93	C	T	17: 37,151,555	C139Y	probably damaging	Het
Pde4c	A	G	8: 70,750,076	N637S	probably benign	Het
Pds5b	T	A	5: 150,779,275	V824D	possibly damaging	Het
Pole2	A	T	12: 69,222,386		probably benign	Het
Ppig	C	T	2: 69,735,976		probably benign	Het
Prep	A	G	10: 45,092,676	Y90C	probably damaging	Het
Proca1	A	T	11: 78,194,905	R11S	probably damaging	Het
Prph	T	A	15: 99,056,991	W313R	probably benign	Het
Prune2	C	T	19: 17,123,080	P1983S	probably benign	Het
Ptbp2	G	A	3: 119,724,198		probably benign	Het
Rsph6a	C	T	7: 19,074,106	P398L	probably damaging	Het
Sdk2	T	C	11: 113,829,967	I1379V	probably benign	Het
Sf3b1	C	T	1: 55,019,271	G53E	probably damaging	Het
Slc9a3	T	C	13: 74,157,784		probably null	Het
Smarcal1	A	T	1: 72,626,473	H710L	probably benign	Het
Soat2	GAGAAG	GAG	15: 102,150,707		probably benign	Het
Sstr4	T	A	2: 148,396,261	V264D	probably damaging	Het
Susd2	A	G	10: 75,639,911	L418P	probably damaging	Het
Synj1	A	G	16: 90,938,640	V1475A	probably benign	Het
Szt2	G	A	4: 118,376,347		probably benign	Het
Tbc1d4	T	C	14: 101,458,063		probably null	Het
Tesk1	A	G	4: 43,446,000	E311G	probably damaging	Het
Tmed5	A	T	5: 108,126,016	V119E	probably damaging	Het
Tmem260	T	C	14: 48,486,867	S201P	possibly damaging	Het
Tnxb	A	G	17: 34,671,733	Y350C	probably damaging	Het
Tpte	T	C	8: 22,335,608		probably benign	Het
Trim37	A	T	11: 87,146,968	D161V	probably damaging	Het
Trrap	C	A	5: 144,814,556	Q1640K	probably damaging	Het
Tspoap1	T	C	11: 87,776,346		probably benign	Het
Ttk	T	A	9: 83,847,260		probably benign	Het
Vmn1r172	A	G	7: 23,660,532	S281G	probably benign	Het
Vmn1r177	A	G	7: 23,865,597	S285P	probably damaging	Het
Vmn1r231	C	T	17: 20,890,399	V85I	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r118	T	C	17: 55,608,643	I436V	probably benign	Het
Vmn2r12	T	C	5: 109,092,899	K116R	probably benign	Het
Vmn2r28	T	A	7: 5,488,514	I245L	probably benign	Het
Wdr26	A	T	1: 181,180,651		probably benign	Het
Xrcc3	A	T	12: 111,809,957	H67Q	probably benign	Het
Zbbx	A	T	3: 75,078,495	S417T	possibly damaging	Het
Zc3h13	A	G	14: 75,323,482	D504G	unknown	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zyg11b	A	T	4: 108,255,308	F388I	probably damaging	Het

Other mutations in Sptan1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00668:Sptan1	APN	2	29993956	critical splice donor site	probably null
IGL00932:Sptan1	APN	2	30015610	missense	probably damaging	1.00
IGL00945:Sptan1	APN	2	30000071	splice site	probably benign
IGL01070:Sptan1	APN	2	30014173	critical splice donor site	probably null
IGL01625:Sptan1	APN	2	30026114	missense	probably damaging	1.00
IGL01657:Sptan1	APN	2	30018479	missense	probably benign	0.12
IGL01795:Sptan1	APN	2	30018489	missense	probably benign	0.07
IGL01982:Sptan1	APN	2	30019968	missense	probably damaging	1.00
IGL02040:Sptan1	APN	2	30013713	missense	probably benign	0.43
IGL02158:Sptan1	APN	2	30030324	missense	probably damaging	0.97
IGL02370:Sptan1	APN	2	30030740	missense	probably damaging	0.99
IGL02507:Sptan1	APN	2	30016055	missense	probably damaging	1.00
IGL02552:Sptan1	APN	2	30018474	missense	probably damaging	0.99
IGL02690:Sptan1	APN	2	29998183	missense	possibly damaging	0.78
IGL02715:Sptan1	APN	2	29978576	missense	probably benign	0.03
IGL02725:Sptan1	APN	2	29996043	missense	probably damaging	0.99
IGL03033:Sptan1	APN	2	29991033	missense	probably damaging	1.00
IGL03304:Sptan1	APN	2	29986493	missense	probably damaging	1.00
IGL03405:Sptan1	APN	2	30025581	missense	probably damaging	0.99
R0058:Sptan1	UTSW	2	29993696	splice site	probably null
R0058:Sptan1	UTSW	2	29993696	splice site	probably null
R0066:Sptan1	UTSW	2	30003667	splice site	probably benign
R0066:Sptan1	UTSW	2	30003667	splice site	probably benign
R0071:Sptan1	UTSW	2	30003342	nonsense	probably null
R0071:Sptan1	UTSW	2	30003342	nonsense	probably null
R0094:Sptan1	UTSW	2	30006623	missense	probably benign	0.37
R0230:Sptan1	UTSW	2	30010692	splice site	probably benign
R0242:Sptan1	UTSW	2	30018401	missense	probably benign	0.00
R0242:Sptan1	UTSW	2	30018401	missense	probably benign	0.00
R0366:Sptan1	UTSW	2	29992752	splice site	probably null
R0368:Sptan1	UTSW	2	29993915	missense	probably benign	0.29
R0423:Sptan1	UTSW	2	30028672	missense	probably null
R0448:Sptan1	UTSW	2	30026810	missense	probably damaging	1.00
R0485:Sptan1	UTSW	2	30013848	splice site	probably benign
R0580:Sptan1	UTSW	2	30007575	missense	probably damaging	0.99
R0739:Sptan1	UTSW	2	30013518	missense	probably damaging	1.00
R0924:Sptan1	UTSW	2	30016028	missense	probably damaging	0.98
R0930:Sptan1	UTSW	2	30016028	missense	probably damaging	0.98
R0961:Sptan1	UTSW	2	29980063	splice site	probably null
R1352:Sptan1	UTSW	2	30021187	splice site	probably benign
R1456:Sptan1	UTSW	2	29980203	critical splice donor site	probably null
R1537:Sptan1	UTSW	2	30026022	missense	possibly damaging	0.95
R1542:Sptan1	UTSW	2	30027127	missense	probably damaging	1.00
R1612:Sptan1	UTSW	2	30003336	missense	probably damaging	1.00
R1623:Sptan1	UTSW	2	29986420	missense	probably damaging	0.96
R1834:Sptan1	UTSW	2	29992001	splice site	probably benign
R1879:Sptan1	UTSW	2	29995528	missense	probably damaging	1.00
R1893:Sptan1	UTSW	2	30020460	missense	probably damaging	0.98
R1914:Sptan1	UTSW	2	30011036	missense	probably benign	0.00
R1915:Sptan1	UTSW	2	30011036	missense	probably benign	0.00
R2022:Sptan1	UTSW	2	30007561	missense	probably damaging	0.96
R2050:Sptan1	UTSW	2	30002238	missense	probably benign
R2103:Sptan1	UTSW	2	30030471	missense	probably damaging	1.00
R2162:Sptan1	UTSW	2	30018576	splice site	probably benign
R2931:Sptan1	UTSW	2	30018488	missense	probably benign
R3726:Sptan1	UTSW	2	30018419	missense	possibly damaging	0.59
R4170:Sptan1	UTSW	2	30030025	missense	possibly damaging	0.93
R4235:Sptan1	UTSW	2	30026588	missense	probably damaging	1.00
R4378:Sptan1	UTSW	2	30025569	missense	probably damaging	1.00
R4424:Sptan1	UTSW	2	30029709	intron	probably benign
R4718:Sptan1	UTSW	2	30031062	missense	probably damaging	1.00
R4777:Sptan1	UTSW	2	29996435	missense	probably damaging	0.98
R4849:Sptan1	UTSW	2	30011042	missense	probably damaging	1.00
R5158:Sptan1	UTSW	2	29978443	missense	probably damaging	1.00
R5180:Sptan1	UTSW	2	29993724	intron	probably benign
R5181:Sptan1	UTSW	2	29993724	intron	probably benign
R5383:Sptan1	UTSW	2	30011328	missense	probably damaging	1.00
R5573:Sptan1	UTSW	2	29986492	nonsense	probably null
R5592:Sptan1	UTSW	2	29986719	intron	probably benign
R5639:Sptan1	UTSW	2	29990993	nonsense	probably null
R5801:Sptan1	UTSW	2	30030601	splice site	probably null
R5947:Sptan1	UTSW	2	29994367	critical splice donor site	probably null
R6056:Sptan1	UTSW	2	29996782	missense	probably benign	0.36
R6090:Sptan1	UTSW	2	29993887	missense	probably damaging	1.00
R6146:Sptan1	UTSW	2	30004523	missense	probably benign	0.01
R6254:Sptan1	UTSW	2	30007549	missense	possibly damaging	0.93
R6366:Sptan1	UTSW	2	30020455	missense	possibly damaging	0.47
R6378:Sptan1	UTSW	2	30018515	missense	probably damaging	1.00
R6521:Sptan1	UTSW	2	30020455	missense	possibly damaging	0.47
R6877:Sptan1	UTSW	2	30030973	missense	probably damaging	0.99
R7173:Sptan1	UTSW	2	29983209	missense	probably benign	0.02
R7248:Sptan1	UTSW	2	30002299	missense	probably benign	0.10
R7282:Sptan1	UTSW	2	29986929	missense	probably damaging	1.00
R7527:Sptan1	UTSW	2	29980197	missense	probably damaging	1.00
R7585:Sptan1	UTSW	2	30000056	missense	probably benign	0.06
R7779:Sptan1	UTSW	2	30021307	missense	probably damaging	1.00
R8051:Sptan1	UTSW	2	30030159	missense	probably damaging	1.00
R8055:Sptan1	UTSW	2	29994339	missense	probably benign	0.22
R8103:Sptan1	UTSW	2	30020043	missense	probably damaging	1.00
R8283:Sptan1	UTSW	2	29980200	missense	probably damaging	1.00
R8507:Sptan1	UTSW	2	30026584	missense	probably damaging	1.00
R8963:Sptan1	UTSW	2	29983732	missense	possibly damaging	0.92
R9126:Sptan1	UTSW	2	30030585	missense	probably damaging	0.99
R9206:Sptan1	UTSW	2	30030712	missense	possibly damaging	0.90
R9273:Sptan1	UTSW	2	29990965	missense	possibly damaging	0.88
X0028:Sptan1	UTSW	2	30020030	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACAACTTGGTGTTGTTTTCCCAACTC -3'
(R):5'- AAAGCAGGACTGACTCTCTGCAAAG -3'

Sequencing Primer
(F):5'- CCACCAAAAATATTGGAAATATGCTG -3'
(R):5'- gctctatctacctgcctcttc -3'

Posted On

2013-04-24