Incidental Mutation 'R0396:Sptan1'
ID 32006
Institutional Source Beutler Lab
Gene Symbol Sptan1
Ensembl Gene ENSMUSG00000057738
Gene Name spectrin alpha, non-erythrocytic 1
Synonyms alpha-fodrin, Spna2, 2610027H02Rik, Spna-2
MMRRC Submission 038602-MU
Accession Numbers

Ncbi RefSeq: NM_001076554.2, NM_001177667.1, NM_001177668.1; MGI:98386

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0396 (G1)
Quality Score 179
Status Validated
Chromosome 2
Chromosomal Location 29965560-30031451 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29991033 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 438 (V438A)
Ref Sequence ENSEMBL: ENSMUSP00000109348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
AlphaFold P16546
Predicted Effect probably damaging
Transcript: ENSMUST00000046257
AA Change: V438A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: V438A

SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095083
AA Change: V438A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: V438A

SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100225
AA Change: V438A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: V438A

SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113717
AA Change: V438A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: V438A

SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113719
AA Change: V438A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: V438A

SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000129241
AA Change: V438A

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: V438A

Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184313
Meta Mutation Damage Score 0.4987 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 89.8%
Validation Efficiency 92% (96/104)
MGI Phenotype Strain: 3714925; 4330132
Lethality: E12-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]
Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,377 V467A possibly damaging Het
4933405L10Rik G A 8: 105,709,780 V194I probably benign Het
Acsm1 A T 7: 119,636,455 I133F probably damaging Het
Adamts9 T A 6: 92,798,005 T1676S probably benign Het
Adcy4 T C 14: 55,772,288 D769G probably benign Het
Aif1 T C 17: 35,171,109 *148W probably null Het
Akna C T 4: 63,392,126 probably benign Het
Arhgap32 G A 9: 32,245,255 probably null Het
Atpaf1 G A 4: 115,785,252 E92K possibly damaging Het
C1s1 T C 6: 124,533,354 E378G probably benign Het
Caprin1 T A 2: 103,769,569 Q108L probably damaging Het
Car13 A T 3: 14,656,239 H154L probably benign Het
Cdon C A 9: 35,470,130 N605K probably damaging Het
Ceacam10 G A 7: 24,781,014 G70E probably damaging Het
Cfap221 G A 1: 119,954,200 T286M probably benign Het
Cfap61 T C 2: 145,949,944 F107S possibly damaging Het
Coil C A 11: 88,981,623 T270N probably benign Het
Crocc2 T G 1: 93,224,214 probably benign Het
Crot T C 5: 8,969,959 E461G probably damaging Het
D130052B06Rik G T 11: 33,623,391 R41L unknown Het
D630045J12Rik T C 6: 38,196,736 S166G possibly damaging Het
Dennd4a T G 9: 64,862,391 V460G probably damaging Het
Depdc7 A T 2: 104,727,323 probably benign Het
Dgkb G A 12: 38,190,135 probably null Het
Dhx57 T G 17: 80,274,797 S407R probably benign Het
Dnase2a G T 8: 84,909,763 probably benign Het
Dqx1 T G 6: 83,059,005 M106R probably benign Het
Eno1b T C 18: 48,047,739 I328T probably benign Het
Ephx2 T G 14: 66,108,063 I151L probably benign Het
Gdf3 C T 6: 122,607,135 G91D probably damaging Het
Gm14124 G A 2: 150,268,053 G221D probably damaging Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gsdme T A 6: 50,221,107 H291L probably benign Het
H2-Bl A G 17: 36,083,722 I103T possibly damaging Het
Hif3a G A 7: 17,052,021 probably benign Het
Hmox2 A T 16: 4,765,763 I232L probably benign Het
Itgb2 A G 10: 77,561,189 Y686C probably damaging Het
Jmjd1c A G 10: 67,219,523 T528A possibly damaging Het
Kdr T C 5: 75,960,728 I541V possibly damaging Het
Khdrbs2 C A 1: 32,519,973 V343L probably damaging Het
Kif16b C T 2: 142,853,659 R175H probably damaging Het
Klri2 T G 6: 129,740,288 E44A possibly damaging Het
Kmt2b G T 7: 30,576,755 T1773K probably damaging Het
Lair1 A G 7: 4,010,786 L154P probably damaging Het
Larp1b G A 3: 40,970,561 V158M probably damaging Het
Lgi3 T A 14: 70,534,840 I275N probably damaging Het
Lrba A G 3: 86,295,179 N246D probably damaging Het
Lrrc45 T A 11: 120,714,907 probably benign Het
Mdh2 G T 5: 135,789,679 V263L probably benign Het
Myom1 T A 17: 71,034,693 V149E probably damaging Het
Nanos1 A T 19: 60,757,041 D259V probably damaging Het
Nedd4l T A 18: 65,161,654 probably benign Het
Npas3 A G 12: 53,831,745 Y150C probably damaging Het
Olfr1066 T C 2: 86,456,019 N84S possibly damaging Het
Olfr1129 T A 2: 87,575,567 V161D possibly damaging Het
Olfr1392 A T 11: 49,293,338 I6F probably benign Het
Olfr479 A T 7: 108,055,963 H327L probably benign Het
Olfr672 G A 7: 104,996,706 A66V probably damaging Het
Olfr93 C T 17: 37,151,555 C139Y probably damaging Het
Pde4c A G 8: 70,750,076 N637S probably benign Het
Pds5b T A 5: 150,779,275 V824D possibly damaging Het
Pole2 A T 12: 69,222,386 probably benign Het
Ppig C T 2: 69,735,976 probably benign Het
Prep A G 10: 45,092,676 Y90C probably damaging Het
Proca1 A T 11: 78,194,905 R11S probably damaging Het
Prph T A 15: 99,056,991 W313R probably benign Het
Prune2 C T 19: 17,123,080 P1983S probably benign Het
Ptbp2 G A 3: 119,724,198 probably benign Het
Rsph6a C T 7: 19,074,106 P398L probably damaging Het
Sdk2 T C 11: 113,829,967 I1379V probably benign Het
Sf3b1 C T 1: 55,019,271 G53E probably damaging Het
Slc9a3 T C 13: 74,157,784 probably null Het
Smarcal1 A T 1: 72,626,473 H710L probably benign Het
Soat2 GAGAAG GAG 15: 102,150,707 probably benign Het
Sstr4 T A 2: 148,396,261 V264D probably damaging Het
Susd2 A G 10: 75,639,911 L418P probably damaging Het
Synj1 A G 16: 90,938,640 V1475A probably benign Het
Szt2 G A 4: 118,376,347 probably benign Het
Tbc1d4 T C 14: 101,458,063 probably null Het
Tesk1 A G 4: 43,446,000 E311G probably damaging Het
Tmed5 A T 5: 108,126,016 V119E probably damaging Het
Tmem260 T C 14: 48,486,867 S201P possibly damaging Het
Tnxb A G 17: 34,671,733 Y350C probably damaging Het
Tpte T C 8: 22,335,608 probably benign Het
Trim37 A T 11: 87,146,968 D161V probably damaging Het
Trrap C A 5: 144,814,556 Q1640K probably damaging Het
Tspoap1 T C 11: 87,776,346 probably benign Het
Ttk T A 9: 83,847,260 probably benign Het
Vmn1r172 A G 7: 23,660,532 S281G probably benign Het
Vmn1r177 A G 7: 23,865,597 S285P probably damaging Het
Vmn1r231 C T 17: 20,890,399 V85I probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r118 T C 17: 55,608,643 I436V probably benign Het
Vmn2r12 T C 5: 109,092,899 K116R probably benign Het
Vmn2r28 T A 7: 5,488,514 I245L probably benign Het
Wdr26 A T 1: 181,180,651 probably benign Het
Xrcc3 A T 12: 111,809,957 H67Q probably benign Het
Zbbx A T 3: 75,078,495 S417T possibly damaging Het
Zc3h13 A G 14: 75,323,482 D504G unknown Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zyg11b A T 4: 108,255,308 F388I probably damaging Het
Other mutations in Sptan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Sptan1 APN 2 29993956 critical splice donor site probably null
IGL00932:Sptan1 APN 2 30015610 missense probably damaging 1.00
IGL00945:Sptan1 APN 2 30000071 splice site probably benign
IGL01070:Sptan1 APN 2 30014173 critical splice donor site probably null
IGL01625:Sptan1 APN 2 30026114 missense probably damaging 1.00
IGL01657:Sptan1 APN 2 30018479 missense probably benign 0.12
IGL01795:Sptan1 APN 2 30018489 missense probably benign 0.07
IGL01982:Sptan1 APN 2 30019968 missense probably damaging 1.00
IGL02040:Sptan1 APN 2 30013713 missense probably benign 0.43
IGL02158:Sptan1 APN 2 30030324 missense probably damaging 0.97
IGL02370:Sptan1 APN 2 30030740 missense probably damaging 0.99
IGL02507:Sptan1 APN 2 30016055 missense probably damaging 1.00
IGL02552:Sptan1 APN 2 30018474 missense probably damaging 0.99
IGL02690:Sptan1 APN 2 29998183 missense possibly damaging 0.78
IGL02715:Sptan1 APN 2 29978576 missense probably benign 0.03
IGL02725:Sptan1 APN 2 29996043 missense probably damaging 0.99
IGL03033:Sptan1 APN 2 29991033 missense probably damaging 1.00
IGL03304:Sptan1 APN 2 29986493 missense probably damaging 1.00
IGL03405:Sptan1 APN 2 30025581 missense probably damaging 0.99
R0058:Sptan1 UTSW 2 29993696 splice site probably null
R0058:Sptan1 UTSW 2 29993696 splice site probably null
R0066:Sptan1 UTSW 2 30003667 splice site probably benign
R0066:Sptan1 UTSW 2 30003667 splice site probably benign
R0071:Sptan1 UTSW 2 30003342 nonsense probably null
R0071:Sptan1 UTSW 2 30003342 nonsense probably null
R0094:Sptan1 UTSW 2 30006623 missense probably benign 0.37
R0230:Sptan1 UTSW 2 30010692 splice site probably benign
R0242:Sptan1 UTSW 2 30018401 missense probably benign 0.00
R0242:Sptan1 UTSW 2 30018401 missense probably benign 0.00
R0366:Sptan1 UTSW 2 29992752 splice site probably null
R0368:Sptan1 UTSW 2 29993915 missense probably benign 0.29
R0423:Sptan1 UTSW 2 30028672 missense probably null
R0448:Sptan1 UTSW 2 30026810 missense probably damaging 1.00
R0485:Sptan1 UTSW 2 30013848 splice site probably benign
R0580:Sptan1 UTSW 2 30007575 missense probably damaging 0.99
R0739:Sptan1 UTSW 2 30013518 missense probably damaging 1.00
R0924:Sptan1 UTSW 2 30016028 missense probably damaging 0.98
R0930:Sptan1 UTSW 2 30016028 missense probably damaging 0.98
R0961:Sptan1 UTSW 2 29980063 splice site probably null
R1352:Sptan1 UTSW 2 30021187 splice site probably benign
R1456:Sptan1 UTSW 2 29980203 critical splice donor site probably null
R1537:Sptan1 UTSW 2 30026022 missense possibly damaging 0.95
R1542:Sptan1 UTSW 2 30027127 missense probably damaging 1.00
R1612:Sptan1 UTSW 2 30003336 missense probably damaging 1.00
R1623:Sptan1 UTSW 2 29986420 missense probably damaging 0.96
R1834:Sptan1 UTSW 2 29992001 splice site probably benign
R1879:Sptan1 UTSW 2 29995528 missense probably damaging 1.00
R1893:Sptan1 UTSW 2 30020460 missense probably damaging 0.98
R1914:Sptan1 UTSW 2 30011036 missense probably benign 0.00
R1915:Sptan1 UTSW 2 30011036 missense probably benign 0.00
R2022:Sptan1 UTSW 2 30007561 missense probably damaging 0.96
R2050:Sptan1 UTSW 2 30002238 missense probably benign
R2103:Sptan1 UTSW 2 30030471 missense probably damaging 1.00
R2162:Sptan1 UTSW 2 30018576 splice site probably benign
R2931:Sptan1 UTSW 2 30018488 missense probably benign
R3726:Sptan1 UTSW 2 30018419 missense possibly damaging 0.59
R4170:Sptan1 UTSW 2 30030025 missense possibly damaging 0.93
R4235:Sptan1 UTSW 2 30026588 missense probably damaging 1.00
R4378:Sptan1 UTSW 2 30025569 missense probably damaging 1.00
R4424:Sptan1 UTSW 2 30029709 intron probably benign
R4718:Sptan1 UTSW 2 30031062 missense probably damaging 1.00
R4777:Sptan1 UTSW 2 29996435 missense probably damaging 0.98
R4849:Sptan1 UTSW 2 30011042 missense probably damaging 1.00
R5158:Sptan1 UTSW 2 29978443 missense probably damaging 1.00
R5180:Sptan1 UTSW 2 29993724 intron probably benign
R5181:Sptan1 UTSW 2 29993724 intron probably benign
R5383:Sptan1 UTSW 2 30011328 missense probably damaging 1.00
R5573:Sptan1 UTSW 2 29986492 nonsense probably null
R5592:Sptan1 UTSW 2 29986719 intron probably benign
R5639:Sptan1 UTSW 2 29990993 nonsense probably null
R5801:Sptan1 UTSW 2 30030601 splice site probably null
R5947:Sptan1 UTSW 2 29994367 critical splice donor site probably null
R6056:Sptan1 UTSW 2 29996782 missense probably benign 0.36
R6090:Sptan1 UTSW 2 29993887 missense probably damaging 1.00
R6146:Sptan1 UTSW 2 30004523 missense probably benign 0.01
R6254:Sptan1 UTSW 2 30007549 missense possibly damaging 0.93
R6366:Sptan1 UTSW 2 30020455 missense possibly damaging 0.47
R6378:Sptan1 UTSW 2 30018515 missense probably damaging 1.00
R6521:Sptan1 UTSW 2 30020455 missense possibly damaging 0.47
R6877:Sptan1 UTSW 2 30030973 missense probably damaging 0.99
R7173:Sptan1 UTSW 2 29983209 missense probably benign 0.02
R7248:Sptan1 UTSW 2 30002299 missense probably benign 0.10
R7282:Sptan1 UTSW 2 29986929 missense probably damaging 1.00
R7527:Sptan1 UTSW 2 29980197 missense probably damaging 1.00
R7585:Sptan1 UTSW 2 30000056 missense probably benign 0.06
R7779:Sptan1 UTSW 2 30021307 missense probably damaging 1.00
R8051:Sptan1 UTSW 2 30030159 missense probably damaging 1.00
R8055:Sptan1 UTSW 2 29994339 missense probably benign 0.22
R8103:Sptan1 UTSW 2 30020043 missense probably damaging 1.00
R8283:Sptan1 UTSW 2 29980200 missense probably damaging 1.00
R8507:Sptan1 UTSW 2 30026584 missense probably damaging 1.00
R8963:Sptan1 UTSW 2 29983732 missense possibly damaging 0.92
R9126:Sptan1 UTSW 2 30030585 missense probably damaging 0.99
R9206:Sptan1 UTSW 2 30030712 missense possibly damaging 0.90
R9273:Sptan1 UTSW 2 29990965 missense possibly damaging 0.88
X0028:Sptan1 UTSW 2 30020030 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gctctatctacctgcctcttc -3'
Posted On 2013-04-24