Incidental Mutation 'R4227:Gpsm1'
ID320065
Institutional Source Beutler Lab
Gene Symbol Gpsm1
Ensembl Gene ENSMUSG00000026930
Gene NameG-protein signalling modulator 1 (AGS3-like, C. elegans)
SynonymsAgs3, 1810037C22Rik
MMRRC Submission 041047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4227 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26315515-26348237 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 26339626 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000066889] [ENSMUST00000066936] [ENSMUST00000078616] [ENSMUST00000114134] [ENSMUST00000127453]
Predicted Effect probably benign
Transcript: ENSMUST00000066889
SMART Domains Protein: ENSMUSP00000067964
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TPR 98 131 1.45e-1 SMART
TPR 138 171 7.06e-5 SMART
TPR 238 271 5.96e-3 SMART
TPR 278 311 1.47e-2 SMART
TPR 318 351 5.19e-3 SMART
TPR 358 391 1.33e0 SMART
GoLoco 525 547 7.38e-9 SMART
low complexity region 548 560 N/A INTRINSIC
GoLoco 578 600 4.24e-9 SMART
GoLoco 626 648 5.22e-9 SMART
GoLoco 660 682 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066936
SMART Domains Protein: ENSMUSP00000065000
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 493 515 7.38e-9 SMART
low complexity region 516 528 N/A INTRINSIC
GoLoco 546 568 4.24e-9 SMART
GoLoco 594 616 5.22e-9 SMART
GoLoco 628 650 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078616
SMART Domains Protein: ENSMUSP00000077686
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 433 455 7.38e-9 SMART
low complexity region 456 468 N/A INTRINSIC
GoLoco 486 508 4.24e-9 SMART
GoLoco 534 556 5.22e-9 SMART
GoLoco 568 590 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114134
SMART Domains Protein: ENSMUSP00000109769
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
GoLoco 56 78 7.38e-9 SMART
low complexity region 79 91 N/A INTRINSIC
GoLoco 109 131 4.24e-9 SMART
GoLoco 157 179 5.22e-9 SMART
GoLoco 191 213 3.58e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123981
Predicted Effect probably benign
Transcript: ENSMUST00000127453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142057
Predicted Effect probably benign
Transcript: ENSMUST00000145884
SMART Domains Protein: ENSMUSP00000115680
Gene: ENSMUSG00000026930

DomainStartEndE-ValueType
Blast:TPR 22 68 1e-9 BLAST
Pfam:TPR_1 82 107 2.3e-4 PFAM
Pfam:TPR_12 82 147 7.9e-12 PFAM
Pfam:TPR_7 84 119 1.4e-5 PFAM
Pfam:TPR_2 122 147 6.2e-4 PFAM
Pfam:TPR_8 123 146 1.4e-2 PFAM
Blast:TPR 150 183 4e-15 BLAST
GoLoco 317 339 7.38e-9 SMART
low complexity region 340 352 N/A INTRINSIC
GoLoco 370 392 4.24e-9 SMART
GoLoco 418 440 5.22e-9 SMART
GoLoco 452 474 3.58e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153064
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G-protein signaling modulators (GPSMs) play diverse functional roles through their interaction with G-protein subunits. This gene encodes a receptor-independent activator of G protein signaling, which is one of several factors that influence the basal activity of G-protein signaling systems. The protein contains seven tetratricopeptide repeats in its N-terminal half and four G-protein regulatory (GPR) motifs in its C-terminal half. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lean phenotype, reduced fat mass, increased food consumption, increased nocturnal energy expenditure and altered blood pressure control mechanisms; surprisingly, their basal behavior and gross brain morphology remain normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Mug2 A T 6: 122,040,732 D476V probably benign Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Odf2 A G 2: 29,901,284 probably benign Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr444 A G 6: 42,955,714 Y72C possibly damaging Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
P3h2 G T 16: 26,105,453 D77E probably benign Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina10 A G 12: 103,628,415 Y182H probably damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Slc17a8 T C 10: 89,598,713 N184S probably damaging Het
Spen C T 4: 141,522,147 S110N unknown Het
Tas1r1 T C 4: 152,028,272 I775V probably damaging Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp131 T C 13: 119,766,746 D455G probably damaging Het
Other mutations in Gpsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Gpsm1 APN 2 26346909 missense probably damaging 1.00
IGL01826:Gpsm1 APN 2 26326302 missense probably damaging 0.98
IGL02281:Gpsm1 APN 2 26339626 splice site probably benign
IGL02730:Gpsm1 APN 2 26325378 missense probably benign 0.13
IGL02740:Gpsm1 APN 2 26340573 missense probably benign 0.43
IGL02749:Gpsm1 APN 2 26339675 missense probably damaging 0.99
IGL02982:Gpsm1 APN 2 26324859 missense probably damaging 1.00
R1271:Gpsm1 UTSW 2 26344672 missense probably damaging 0.99
R1639:Gpsm1 UTSW 2 26345187 missense probably damaging 1.00
R1766:Gpsm1 UTSW 2 26325383 missense probably damaging 1.00
R1854:Gpsm1 UTSW 2 26344713 missense probably damaging 1.00
R2900:Gpsm1 UTSW 2 26345162 missense probably benign 0.00
R2994:Gpsm1 UTSW 2 26319831 unclassified probably benign
R2995:Gpsm1 UTSW 2 26319831 unclassified probably benign
R2996:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4391:Gpsm1 UTSW 2 26323997 missense probably damaging 1.00
R4413:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4461:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4469:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4659:Gpsm1 UTSW 2 26319831 unclassified probably benign
R4786:Gpsm1 UTSW 2 26322481 missense probably benign 0.01
R5025:Gpsm1 UTSW 2 26319996 missense possibly damaging 0.90
R5057:Gpsm1 UTSW 2 26325357 missense probably damaging 0.96
R5171:Gpsm1 UTSW 2 26327464 intron probably benign
R5356:Gpsm1 UTSW 2 26340562 missense possibly damaging 0.73
R5417:Gpsm1 UTSW 2 26324033 critical splice donor site probably null
R5967:Gpsm1 UTSW 2 26340534 unclassified probably null
R6153:Gpsm1 UTSW 2 26325413 missense probably benign 0.14
R6969:Gpsm1 UTSW 2 26340543 missense probably benign 0.01
R7006:Gpsm1 UTSW 2 26322560 missense probably damaging 1.00
R7819:Gpsm1 UTSW 2 26339693 missense probably damaging 0.98
R7867:Gpsm1 UTSW 2 26340436 missense probably benign 0.38
R8194:Gpsm1 UTSW 2 26327352 frame shift probably null
RF017:Gpsm1 UTSW 2 26324872 missense probably damaging 1.00
Z1176:Gpsm1 UTSW 2 26327345 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CTTGCCTGGCTCATCTAGTG -3'
(R):5'- GAAGAAGATTCATCTCCCAGGGG -3'

Sequencing Primer
(F):5'- TCATCTAGTGCCCACAGTGAC -3'
(R):5'- CCAAAGAGTGTGCTGACAGCTC -3'
Posted On2015-06-12