Incidental Mutation 'R4227:Odf2'
ID320066
Institutional Source Beutler Lab
Gene Symbol Odf2
Ensembl Gene ENSMUSG00000026790
Gene Nameouter dense fiber of sperm tails 2
SynonymsMMTEST29, cenexin
MMRRC Submission 041047-MU
Accession Numbers

Genbank: NM_001113213; MGI: 1098824 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4227 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29889221-29931746 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 29901284 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028128] [ENSMUST00000046571] [ENSMUST00000113755] [ENSMUST00000113756] [ENSMUST00000113757] [ENSMUST00000113759] [ENSMUST00000113762] [ENSMUST00000113763] [ENSMUST00000113764] [ENSMUST00000113765] [ENSMUST00000113767] [ENSMUST00000123335] [ENSMUST00000133233] [ENSMUST00000184845]
Predicted Effect probably benign
Transcript: ENSMUST00000028128
SMART Domains Protein: ENSMUSP00000028128
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000046571
SMART Domains Protein: ENSMUSP00000049272
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113755
SMART Domains Protein: ENSMUSP00000109384
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_1 262 298 2.12e-5 PROSPERO
internal_repeat_1 461 495 2.12e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113756
SMART Domains Protein: ENSMUSP00000109385
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113757
SMART Domains Protein: ENSMUSP00000109386
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 101 119 9.13e-6 PROSPERO
coiled coil region 120 192 N/A INTRINSIC
internal_repeat_2 199 217 9.13e-6 PROSPERO
internal_repeat_1 243 279 3.83e-7 PROSPERO
internal_repeat_1 442 476 3.83e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113759
SMART Domains Protein: ENSMUSP00000109388
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.82e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.82e-5 PROSPERO
internal_repeat_1 262 299 1.55e-6 PROSPERO
internal_repeat_1 462 496 1.55e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113762
SMART Domains Protein: ENSMUSP00000109391
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 144 216 N/A INTRINSIC
internal_repeat_1 267 303 1.9e-5 PROSPERO
internal_repeat_1 466 500 1.9e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113763
SMART Domains Protein: ENSMUSP00000109392
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113764
SMART Domains Protein: ENSMUSP00000109393
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 125 197 N/A INTRINSIC
internal_repeat_1 248 284 1.04e-5 PROSPERO
internal_repeat_1 447 481 1.04e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113765
SMART Domains Protein: ENSMUSP00000109394
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 125 143 1.66e-5 PROSPERO
coiled coil region 144 216 N/A INTRINSIC
internal_repeat_2 223 241 1.66e-5 PROSPERO
internal_repeat_1 267 303 7.56e-7 PROSPERO
internal_repeat_1 466 500 7.56e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113767
SMART Domains Protein: ENSMUSP00000109396
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
coiled coil region 188 260 N/A INTRINSIC
internal_repeat_1 311 347 3e-5 PROSPERO
internal_repeat_1 510 544 3e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000123335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130899
Predicted Effect probably benign
Transcript: ENSMUST00000133233
Predicted Effect probably benign
Transcript: ENSMUST00000137558
SMART Domains Protein: ENSMUSP00000117887
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 143 215 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153216
Predicted Effect probably benign
Transcript: ENSMUST00000184845
SMART Domains Protein: ENSMUSP00000139390
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_1 262 298 3.95e-5 PROSPERO
internal_repeat_1 461 495 3.95e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The outer dense fibers are cytoskeletal structures that surround the axoneme in the middle piece and principal piece of the sperm tail. The fibers function in maintaining the elastic structure and recoil of the sperm tail as well as in protecting the tail from shear forces during epididymal transport and ejaculation. Defects in the outer dense fibers lead to abnormal sperm morphology and infertility. This gene encodes one of the major outer dense fiber proteins. Alternative splicing results in multiple transcript variants. The longer transcripts, also known as 'Cenexins', encode proteins with a C-terminal extension that are differentially targeted to somatic centrioles and thought to be crucial for the formation of microtubule organizing centers. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality before implantation and transmission ratio distortion while all heterozygous males display normal development and fertility. Males heterozygous for other alleles are either infertile orshow reduced fertility. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Gpsm1 T C 2: 26,339,626 probably benign Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Mug2 A T 6: 122,040,732 D476V probably benign Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr444 A G 6: 42,955,714 Y72C possibly damaging Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
P3h2 G T 16: 26,105,453 D77E probably benign Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina10 A G 12: 103,628,415 Y182H probably damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Slc17a8 T C 10: 89,598,713 N184S probably damaging Het
Spen C T 4: 141,522,147 S110N unknown Het
Tas1r1 T C 4: 152,028,272 I775V probably damaging Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp131 T C 13: 119,766,746 D455G probably damaging Het
Other mutations in Odf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Odf2 APN 2 29893059 missense probably damaging 1.00
IGL01511:Odf2 APN 2 29914309 splice site probably benign
IGL01760:Odf2 APN 2 29914460 missense probably damaging 1.00
IGL02487:Odf2 APN 2 29920839 missense possibly damaging 0.80
IGL03047:Odf2 APN 2 29920895 splice site probably benign
IGL03057:Odf2 APN 2 29923645 intron probably benign
IGL03064:Odf2 APN 2 29901079 missense probably benign 0.28
3-1:Odf2 UTSW 2 29904075 nonsense probably null
IGL02837:Odf2 UTSW 2 29926713 missense probably damaging 0.99
R4025:Odf2 UTSW 2 29926815 missense probably damaging 1.00
R4357:Odf2 UTSW 2 29892244 missense probably benign 0.00
R4417:Odf2 UTSW 2 29915321 splice site probably benign
R4512:Odf2 UTSW 2 29926097 unclassified probably null
R4705:Odf2 UTSW 2 29904034 missense probably damaging 1.00
R4815:Odf2 UTSW 2 29902240 missense possibly damaging 0.87
R5325:Odf2 UTSW 2 29912571 missense probably benign 0.19
R5614:Odf2 UTSW 2 29920867 missense probably damaging 0.99
R6998:Odf2 UTSW 2 29912617 missense probably benign 0.43
R7740:Odf2 UTSW 2 29930624 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTGGTCTCGGTGATGC -3'
(R):5'- GCGCTACATAGTGAGATGATGC -3'

Sequencing Primer
(F):5'- CTCGGTGATGCGATTAAGTGACC -3'
(R):5'- TGAGATGATGCCTCACACAAC -3'
Posted On2015-06-12