Incidental Mutation 'R4227:Tas1r1'
ID320076
Institutional Source Beutler Lab
Gene Symbol Tas1r1
Ensembl Gene ENSMUSG00000028950
Gene Nametaste receptor, type 1, member 1
SynonymsTR1, T1r1, Gpr70, T1R1
MMRRC Submission 041047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4227 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152027914-152038568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152028272 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 775 (I775V)
Ref Sequence ENSEMBL: ENSMUSP00000030792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030792] [ENSMUST00000066715] [ENSMUST00000131935] [ENSMUST00000155389] [ENSMUST00000156748]
Predicted Effect probably damaging
Transcript: ENSMUST00000030792
AA Change: I775V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030792
Gene: ENSMUSG00000028950
AA Change: I775V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 456 1.7e-69 PFAM
Pfam:NCD3G 494 546 2.1e-15 PFAM
Pfam:7tm_3 578 815 3.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066715
SMART Domains Protein: ENSMUSP00000067521
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
ZnF_C2H2 400 423 2.49e-1 SMART
ZnF_C2H2 429 452 2.57e-3 SMART
ZnF_C2H2 458 480 9.73e-4 SMART
ZnF_C2H2 486 508 3.21e-4 SMART
ZnF_C2H2 514 537 1.67e-2 SMART
ZnF_C2H2 543 565 1.95e-3 SMART
ZnF_C2H2 571 593 5.67e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123696
Predicted Effect probably benign
Transcript: ENSMUST00000131935
SMART Domains Protein: ENSMUSP00000116423
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147982
AA Change: D1447G
Predicted Effect probably benign
Transcript: ENSMUST00000155389
SMART Domains Protein: ENSMUSP00000114726
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
BTB 26 119 1.35e-21 SMART
ZnF_C2H2 284 306 1.64e-1 SMART
ZnF_C2H2 312 332 2.06e1 SMART
ZnF_C2H2 343 365 5.99e-4 SMART
ZnF_C2H2 371 394 9.58e-3 SMART
low complexity region 403 418 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155441
Predicted Effect probably benign
Transcript: ENSMUST00000156748
SMART Domains Protein: ENSMUSP00000117079
Gene: ENSMUSG00000028952

DomainStartEndE-ValueType
ZnF_C2H2 80 102 1.64e-1 SMART
ZnF_C2H2 108 128 2.06e1 SMART
Meta Mutation Damage Score 0.1113 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor and is a component of the heterodimeric amino acid taste receptor T1R1+3. The T1R1+3 receptor responds to L-amino acids but not to D-enantiomers or other compounds. Most amino acids that are perceived as sweet activate T1R1+3, and this activation is strictly dependent on an intact T1R1+3 heterodimer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutant mice show diminished behavioral and nervous responses to umami tastants. Response to sweet tastants is unimpaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Gpsm1 T C 2: 26,339,626 probably benign Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Mug2 A T 6: 122,040,732 D476V probably benign Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Odf2 A G 2: 29,901,284 probably benign Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr444 A G 6: 42,955,714 Y72C possibly damaging Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
P3h2 G T 16: 26,105,453 D77E probably benign Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina10 A G 12: 103,628,415 Y182H probably damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Slc17a8 T C 10: 89,598,713 N184S probably damaging Het
Spen C T 4: 141,522,147 S110N unknown Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp131 T C 13: 119,766,746 D455G probably damaging Het
Other mutations in Tas1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02708:Tas1r1 APN 4 152028340 missense possibly damaging 0.82
IGL02867:Tas1r1 APN 4 152028278 missense probably damaging 1.00
R1547:Tas1r1 UTSW 4 152028419 missense probably damaging 1.00
R1775:Tas1r1 UTSW 4 152038218 nonsense probably null
R1803:Tas1r1 UTSW 4 152032248 missense probably damaging 0.99
R2037:Tas1r1 UTSW 4 152028170 missense probably damaging 1.00
R2083:Tas1r1 UTSW 4 152028391 missense probably benign 0.02
R3821:Tas1r1 UTSW 4 152034681 missense probably benign
R3912:Tas1r1 UTSW 4 152031924 missense probably damaging 0.97
R4272:Tas1r1 UTSW 4 152032157 missense possibly damaging 0.70
R4273:Tas1r1 UTSW 4 152032157 missense possibly damaging 0.70
R4818:Tas1r1 UTSW 4 152032674 missense probably benign 0.15
R5567:Tas1r1 UTSW 4 152038325 missense probably damaging 0.99
R6183:Tas1r1 UTSW 4 152032541 missense probably damaging 1.00
R7162:Tas1r1 UTSW 4 152032238 missense possibly damaging 0.91
R7427:Tas1r1 UTSW 4 152038308 missense probably benign 0.39
R7535:Tas1r1 UTSW 4 152028362 missense probably benign 0.06
R7736:Tas1r1 UTSW 4 152032466 missense probably benign 0.17
R7796:Tas1r1 UTSW 4 152034755 missense probably benign 0.01
R8078:Tas1r1 UTSW 4 152028346 missense probably damaging 1.00
R8255:Tas1r1 UTSW 4 152032317 missense probably benign 0.18
Z1177:Tas1r1 UTSW 4 152032214 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTGCCCATTCTCAACAGC -3'
(R):5'- TTGAGTGCACAGAGGTCAAC -3'

Sequencing Primer
(F):5'- ATCAGGTAGTGCCGCAGC -3'
(R):5'- AGGTCAACTCTGTGGGCTTCC -3'
Posted On2015-06-12