Incidental Mutation 'R4227:Olfr444'
ID320080
Institutional Source Beutler Lab
Gene Symbol Olfr444
Ensembl Gene ENSMUSG00000073110
Gene Nameolfactory receptor 444
SynonymsMOR261-2, GA_x6K02T2P3E9-4602571-4601639
MMRRC Submission 041047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4227 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42949067-42956764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42955714 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 72 (Y72C)
Ref Sequence ENSEMBL: ENSMUSP00000144691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095955] [ENSMUST00000204092]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095955
AA Change: Y72C

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093649
Gene: ENSMUSG00000073110
AA Change: Y72C

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1e-60 PFAM
Pfam:7tm_1 40 289 6.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204092
AA Change: Y72C

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144691
Gene: ENSMUSG00000073110
AA Change: Y72C

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.6e-60 PFAM
Pfam:7tm_1 40 289 3.5e-26 PFAM
Meta Mutation Damage Score 0.1670 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Gpsm1 T C 2: 26,339,626 probably benign Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Mug2 A T 6: 122,040,732 D476V probably benign Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Odf2 A G 2: 29,901,284 probably benign Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
P3h2 G T 16: 26,105,453 D77E probably benign Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina10 A G 12: 103,628,415 Y182H probably damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Slc17a8 T C 10: 89,598,713 N184S probably damaging Het
Spen C T 4: 141,522,147 S110N unknown Het
Tas1r1 T C 4: 152,028,272 I775V probably damaging Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp131 T C 13: 119,766,746 D455G probably damaging Het
Other mutations in Olfr444
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Olfr444 APN 6 42956436 utr 3 prime probably benign
IGL02135:Olfr444 APN 6 42955651 missense probably damaging 0.99
IGL02323:Olfr444 APN 6 42955983 missense probably benign 0.02
IGL02398:Olfr444 APN 6 42956112 missense probably benign 0.02
IGL02622:Olfr444 APN 6 42955729 missense probably damaging 0.99
R0077:Olfr444 UTSW 6 42955773 missense probably benign 0.13
R0416:Olfr444 UTSW 6 42955570 missense probably benign
R0959:Olfr444 UTSW 6 42955752 missense probably benign
R1181:Olfr444 UTSW 6 42955558 missense probably benign 0.23
R1347:Olfr444 UTSW 6 42955705 missense probably damaging 1.00
R1347:Olfr444 UTSW 6 42955705 missense probably damaging 1.00
R1604:Olfr444 UTSW 6 42955716 missense possibly damaging 0.73
R3021:Olfr444 UTSW 6 42956184 missense possibly damaging 0.91
R4226:Olfr444 UTSW 6 42955755 missense probably benign
R4776:Olfr444 UTSW 6 42955521 missense probably benign 0.00
R5941:Olfr444 UTSW 6 42955716 missense possibly damaging 0.86
R7539:Olfr444 UTSW 6 42956103 missense possibly damaging 0.95
R7763:Olfr444 UTSW 6 42955789 missense probably benign 0.00
X0063:Olfr444 UTSW 6 42956019 missense possibly damaging 0.64
Z1176:Olfr444 UTSW 6 42955690 missense probably damaging 1.00
Z1176:Olfr444 UTSW 6 42956298 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTCCAAGCAGACCTGAGTGTG -3'
(R):5'- AAGCCAGCTATCCAGGAGACAG -3'

Sequencing Primer
(F):5'- CAGACCTGAGTGTGGAGTG -3'
(R):5'- GGTACACACTTTCCAACTCATGATG -3'
Posted On2015-06-12