Incidental Mutation 'R4227:Mug2'
ID320084
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Namemurinoglobulin 2
Synonyms
MMRRC Submission 041047-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4227 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location122006761-122085965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122040732 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 476 (D476V)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
Predicted Effect probably benign
Transcript: ENSMUST00000081777
AA Change: D476V

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: D476V

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Gpsm1 T C 2: 26,339,626 probably benign Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Odf2 A G 2: 29,901,284 probably benign Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr444 A G 6: 42,955,714 Y72C possibly damaging Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
P3h2 G T 16: 26,105,453 D77E probably benign Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina10 A G 12: 103,628,415 Y182H probably damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Slc17a8 T C 10: 89,598,713 N184S probably damaging Het
Spen C T 4: 141,522,147 S110N unknown Het
Tas1r1 T C 4: 152,028,272 I775V probably damaging Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp131 T C 13: 119,766,746 D455G probably damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R7917:Mug2 UTSW 6 122036282 missense probably benign
R7933:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCTAGGCAATCTACAGC -3'
(R):5'- TACCCAGATAGAACCCAATGTG -3'

Sequencing Primer
(F):5'- GTTGTTTCTCCAGGTCAACCACAAAG -3'
(R):5'- CCCAGATAGAACCCAATGTGTATAG -3'
Posted On2015-06-12