Incidental Mutation 'R4227:Setd1a'
ID 320090
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 041047-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4227 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to A at 127395819 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046863] [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000106271] [ENSMUST00000106272] [ENSMUST00000154987] [ENSMUST00000155005] [ENSMUST00000125188] [ENSMUST00000206674] [ENSMUST00000138432] [ENSMUST00000139068]
AlphaFold E9PYH6
Predicted Effect probably benign
Transcript: ENSMUST00000046863
SMART Domains Protein: ENSMUSP00000036245
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:KR 11 147 3e-10 PFAM
Pfam:RmlD_sub_bind 11 198 8.1e-10 PFAM
Pfam:Polysacc_synt_2 12 140 4.6e-13 PFAM
Pfam:NmrA 12 142 1.9e-9 PFAM
Pfam:Epimerase 12 215 3.2e-25 PFAM
Pfam:GDP_Man_Dehyd 13 185 8.1e-17 PFAM
Pfam:3Beta_HSD 13 290 5.4e-99 PFAM
Pfam:NAD_binding_4 14 240 1.4e-15 PFAM
transmembrane domain 312 334 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000047075
AA Change: Q1462K
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: Q1462K

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000047157
AA Change: Q1462K
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: Q1462K

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106271
SMART Domains Protein: ENSMUSP00000101878
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 1.3e-13 PFAM
Pfam:RmlD_sub_bind 10 186 3.7e-10 PFAM
Pfam:KR 11 140 5.7e-10 PFAM
Pfam:Polysacc_synt_2 12 140 2.8e-13 PFAM
Pfam:NmrA 12 141 2.7e-9 PFAM
Pfam:Epimerase 12 220 2.9e-26 PFAM
Pfam:NAD_binding_10 13 186 2.3e-11 PFAM
Pfam:3Beta_HSD 13 216 1e-70 PFAM
Pfam:NAD_binding_4 14 183 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106272
SMART Domains Protein: ENSMUSP00000101879
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:adh_short 10 143 3.7e-13 PFAM
Pfam:RmlD_sub_bind 10 180 2.8e-9 PFAM
Pfam:KR 11 139 1.6e-9 PFAM
Pfam:Polysacc_synt_2 12 140 7.7e-13 PFAM
Pfam:NmrA 12 141 7.3e-9 PFAM
Pfam:Epimerase 12 215 7.1e-26 PFAM
Pfam:NAD_binding_10 13 179 1.1e-10 PFAM
Pfam:3Beta_HSD 13 188 6.1e-70 PFAM
Pfam:NAD_binding_4 14 187 1.5e-17 PFAM
Pfam:3Beta_HSD 177 261 4e-23 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124631
Predicted Effect unknown
Transcript: ENSMUST00000154987
AA Change: Q919K
Predicted Effect probably benign
Transcript: ENSMUST00000155005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206995
Predicted Effect probably benign
Transcript: ENSMUST00000125188
Predicted Effect probably benign
Transcript: ENSMUST00000206674
Predicted Effect probably benign
Transcript: ENSMUST00000136823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136597
Predicted Effect probably benign
Transcript: ENSMUST00000138432
SMART Domains Protein: ENSMUSP00000114536
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 18 78 1.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139068
SMART Domains Protein: ENSMUSP00000121246
Gene: ENSMUSG00000042289

DomainStartEndE-ValueType
Pfam:3Beta_HSD 13 55 2.7e-13 PFAM
Pfam:3Beta_HSD 53 100 3.2e-19 PFAM
Meta Mutation Damage Score 0.1420 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,115,120 (GRCm39) T609A probably damaging Het
Agbl2 T G 2: 90,631,797 (GRCm39) L385R probably damaging Het
Arfgef2 A T 2: 166,709,244 (GRCm39) D1107V probably damaging Het
Arhgef5 C T 6: 43,256,432 (GRCm39) A1180V probably damaging Het
B9d1 C G 11: 61,403,483 (GRCm39) R160G probably damaging Het
Birc6 T C 17: 74,926,835 (GRCm39) probably null Het
Capn11 A G 17: 45,953,392 (GRCm39) probably null Het
Ceacam12 G T 7: 17,805,678 (GRCm39) M288I probably benign Het
Cfhr3 T A 1: 139,536,046 (GRCm39) noncoding transcript Het
Copa A G 1: 171,945,682 (GRCm39) probably benign Het
Cypt4 A G 9: 24,536,788 (GRCm39) M93V probably benign Het
Fat3 G A 9: 16,288,989 (GRCm39) T178I probably damaging Het
Gm15931 A G 7: 4,277,793 (GRCm39) noncoding transcript Het
Gm9871 A G 6: 101,773,654 (GRCm39) noncoding transcript Het
Gpsm1 T C 2: 26,229,638 (GRCm39) probably benign Het
Grhl1 A G 12: 24,661,850 (GRCm39) T510A probably benign Het
Kcnn3 A C 3: 89,428,482 (GRCm39) H236P possibly damaging Het
Kif21b T A 1: 136,081,831 (GRCm39) probably null Het
Lcn3 G T 2: 25,656,123 (GRCm39) M59I probably benign Het
Mrps27 C G 13: 99,547,848 (GRCm39) P253A probably damaging Het
Mug2 A T 6: 122,017,691 (GRCm39) D476V probably benign Het
Naca A T 10: 127,877,530 (GRCm39) probably benign Het
Naip5 A G 13: 100,349,276 (GRCm39) S1351P probably damaging Het
Odf2 A G 2: 29,791,296 (GRCm39) probably benign Het
Or2a56 A G 6: 42,932,648 (GRCm39) Y72C possibly damaging Het
Or4g17 A G 2: 111,209,410 (GRCm39) K22E probably benign Het
Or52ab7 A T 7: 102,978,026 (GRCm39) H111L probably damaging Het
Or5w18 T A 2: 87,633,219 (GRCm39) I162N probably damaging Het
P3h2 G T 16: 25,924,203 (GRCm39) D77E probably benign Het
Pcbp2 A G 15: 102,387,066 (GRCm39) M87V probably benign Het
Plekhg6 A G 6: 125,355,768 (GRCm39) L12P probably damaging Het
Plekhh2 A G 17: 84,874,223 (GRCm39) T503A probably benign Het
Pnpla3 C A 15: 84,063,391 (GRCm39) N256K probably benign Het
Polh A G 17: 46,483,520 (GRCm39) S582P probably benign Het
Ptprb T C 10: 116,138,130 (GRCm39) Y345H possibly damaging Het
Rasl11b T A 5: 74,358,852 (GRCm39) I119N probably damaging Het
Rnaseh2a G A 8: 85,686,702 (GRCm39) T149I possibly damaging Het
Serpina10 A G 12: 103,594,674 (GRCm39) Y182H probably damaging Het
Serpina1d A G 12: 103,733,740 (GRCm39) V188A probably benign Het
Slc17a8 T C 10: 89,434,575 (GRCm39) N184S probably damaging Het
Spen C T 4: 141,249,458 (GRCm39) S110N unknown Het
Tas1r1 T C 4: 152,112,729 (GRCm39) I775V probably damaging Het
Tktl2 A G 8: 66,966,351 (GRCm39) probably null Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Tmprss6 C T 15: 78,330,899 (GRCm39) V43M probably damaging Het
Try5 A G 6: 41,290,401 (GRCm39) Y28H possibly damaging Het
Urad A T 5: 147,252,100 (GRCm39) F117L probably damaging Het
Vegfc A G 8: 54,612,445 (GRCm39) Y156C probably damaging Het
Vmn2r45 A T 7: 8,486,277 (GRCm39) V337E probably damaging Het
Vmn2r6 A T 3: 64,445,369 (GRCm39) F696L probably damaging Het
Wnk2 C T 13: 49,244,313 (GRCm39) D508N probably damaging Het
Zfp131 T C 13: 120,228,282 (GRCm39) D455G probably damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GAGTCTTCAGAAAGCAGCAGC -3'
(R):5'- AGTGCAGCCCTAAGAGTGAC -3'

Sequencing Primer
(F):5'- CTTCAGAAAGCAGCAGCAGCAG -3'
(R):5'- GACCTGAGGATAACATTTCTTGCCAC -3'
Posted On 2015-06-12