Incidental Mutation 'R4227:Slc17a8'
ID320095
Institutional Source Beutler Lab
Gene Symbol Slc17a8
Ensembl Gene ENSMUSG00000019935
Gene Namesolute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8
SynonymsVglut3
MMRRC Submission 041047-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4227 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location89574020-89621253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89598713 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 184 (N184S)
Ref Sequence ENSEMBL: ENSMUSP00000020102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020102] [ENSMUST00000105295]
Predicted Effect probably damaging
Transcript: ENSMUST00000020102
AA Change: N184S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020102
Gene: ENSMUSG00000019935
AA Change: N184S

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
internal_repeat_1 62 77 3.74e-7 PROSPERO
internal_repeat_1 75 90 3.74e-7 PROSPERO
Pfam:MFS_1 95 478 1e-46 PFAM
transmembrane domain 493 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105295
SMART Domains Protein: ENSMUSP00000100932
Gene: ENSMUSG00000019935

DomainStartEndE-ValueType
Pfam:MFS_1 1 294 1.1e-34 PFAM
transmembrane domain 309 331 N/A INTRINSIC
Meta Mutation Damage Score 0.1592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a vesicular glutamate transporter. The encoded protein transports the neurotransmitter glutamate into synaptic vesicles before it is released into the synaptic cleft. Mutations in this gene are the cause of autosomal-dominant nonsyndromic type 25 deafness. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sensorineural hearing loss, cochlear ganglion degeneration, decreased synaptic glutamate release, and nonconvulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Gpsm1 T C 2: 26,339,626 probably benign Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Mug2 A T 6: 122,040,732 D476V probably benign Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Odf2 A G 2: 29,901,284 probably benign Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr444 A G 6: 42,955,714 Y72C possibly damaging Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
P3h2 G T 16: 26,105,453 D77E probably benign Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina10 A G 12: 103,628,415 Y182H probably damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Spen C T 4: 141,522,147 S110N unknown Het
Tas1r1 T C 4: 152,028,272 I775V probably damaging Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp131 T C 13: 119,766,746 D455G probably damaging Het
Other mutations in Slc17a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Slc17a8 APN 10 89591295 missense possibly damaging 0.70
IGL00990:Slc17a8 APN 10 89576530 missense probably benign 0.01
IGL01317:Slc17a8 APN 10 89620804 missense probably benign 0.02
IGL01339:Slc17a8 APN 10 89591244 missense probably damaging 1.00
IGL01468:Slc17a8 APN 10 89592021 critical splice donor site probably null
IGL02401:Slc17a8 APN 10 89576660 splice site probably null
IGL02638:Slc17a8 APN 10 89576603 nonsense probably null
IGL02859:Slc17a8 APN 10 89576584 missense probably benign 0.11
R0518:Slc17a8 UTSW 10 89576330 missense probably benign 0.00
R0521:Slc17a8 UTSW 10 89576330 missense probably benign 0.00
R0610:Slc17a8 UTSW 10 89576626 missense probably damaging 0.99
R0846:Slc17a8 UTSW 10 89606734 missense possibly damaging 0.81
R0928:Slc17a8 UTSW 10 89598683 missense probably damaging 1.00
R1277:Slc17a8 UTSW 10 89597457 missense possibly damaging 0.80
R1401:Slc17a8 UTSW 10 89591214 missense probably damaging 1.00
R1854:Slc17a8 UTSW 10 89606765 missense unknown
R1935:Slc17a8 UTSW 10 89577915 missense probably benign 0.03
R1936:Slc17a8 UTSW 10 89577915 missense probably benign 0.03
R3887:Slc17a8 UTSW 10 89591138 splice site probably benign
R4872:Slc17a8 UTSW 10 89576505 missense probably benign 0.38
R5023:Slc17a8 UTSW 10 89576560 missense probably benign 0.01
R5330:Slc17a8 UTSW 10 89589494 critical splice donor site probably null
R5331:Slc17a8 UTSW 10 89589494 critical splice donor site probably null
R5576:Slc17a8 UTSW 10 89597502 missense probably damaging 1.00
R5593:Slc17a8 UTSW 10 89606840 missense probably benign
R6035:Slc17a8 UTSW 10 89592075 missense possibly damaging 0.67
R6035:Slc17a8 UTSW 10 89592075 missense possibly damaging 0.67
R7038:Slc17a8 UTSW 10 89600221 missense probably benign 0.00
R7220:Slc17a8 UTSW 10 89576413 missense probably benign
R7514:Slc17a8 UTSW 10 89592107 missense probably damaging 1.00
R7574:Slc17a8 UTSW 10 89592146 missense probably benign 0.01
R7689:Slc17a8 UTSW 10 89597457 missense possibly damaging 0.80
X0021:Slc17a8 UTSW 10 89598682 missense probably damaging 1.00
X0067:Slc17a8 UTSW 10 89592912 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAACCTTAGTCCCTTTGGAG -3'
(R):5'- CTCCCATCTCTGAAATCACAACT -3'

Sequencing Primer
(F):5'- GAAACTTGAGATTCCCCCTGC -3'
(R):5'- CACGGCCCTATTTTATTGAGACAGG -3'
Posted On2015-06-12