Incidental Mutation 'R4227:Zfp131'
ID320106
Institutional Source Beutler Lab
Gene Symbol Zfp131
Ensembl Gene ENSMUSG00000094870
Gene Namezinc finger protein 131
Synonyms2610109I01Rik, Znf131
MMRRC Submission 041047-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R4227 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location119765187-119790889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119766746 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 455 (D455G)
Ref Sequence ENSEMBL: ENSMUSP00000152941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177916] [ENSMUST00000178271] [ENSMUST00000223722] [ENSMUST00000223813]
Predicted Effect probably damaging
Transcript: ENSMUST00000177916
AA Change: D489G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136867
Gene: ENSMUSG00000094870
AA Change: D489G

DomainStartEndE-ValueType
BTB 34 129 4.83e-23 SMART
low complexity region 205 216 N/A INTRINSIC
ZnF_C2H2 261 283 6.23e-2 SMART
ZnF_C2H2 288 311 2.02e-1 SMART
ZnF_C2H2 328 350 4.11e-2 SMART
ZnF_C2H2 356 376 1.09e2 SMART
ZnF_C2H2 392 414 8.47e-4 SMART
ZnF_C2H2 420 443 1.14e0 SMART
low complexity region 532 548 N/A INTRINSIC
low complexity region 581 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178271
AA Change: D455G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136019
Gene: ENSMUSG00000094870
AA Change: D455G

DomainStartEndE-ValueType
BTB 34 129 4.83e-23 SMART
low complexity region 205 216 N/A INTRINSIC
ZnF_C2H2 254 277 2.02e-1 SMART
ZnF_C2H2 294 316 4.11e-2 SMART
ZnF_C2H2 322 342 1.09e2 SMART
ZnF_C2H2 358 380 8.47e-4 SMART
ZnF_C2H2 386 409 1.14e0 SMART
low complexity region 498 514 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223722
AA Change: D489G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223813
AA Change: D455G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224796
Meta Mutation Damage Score 0.3022 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: This gene encodes a member of the BTB/POZ family of transcription factors. This protein has been found to act as a transcriptional activator and may regulate estrogen receptor signaling. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Gpsm1 T C 2: 26,339,626 probably benign Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Mug2 A T 6: 122,040,732 D476V probably benign Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Odf2 A G 2: 29,901,284 probably benign Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr444 A G 6: 42,955,714 Y72C possibly damaging Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
P3h2 G T 16: 26,105,453 D77E probably benign Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina10 A G 12: 103,628,415 Y182H probably damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Slc17a8 T C 10: 89,598,713 N184S probably damaging Het
Spen C T 4: 141,522,147 S110N unknown Het
Tas1r1 T C 4: 152,028,272 I775V probably damaging Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Other mutations in Zfp131
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1444:Zfp131 UTSW 13 119790248 missense probably damaging 0.99
R1604:Zfp131 UTSW 13 119768780 missense probably damaging 1.00
R1605:Zfp131 UTSW 13 119768780 missense probably damaging 1.00
R1712:Zfp131 UTSW 13 119766543 missense probably benign 0.00
R1899:Zfp131 UTSW 13 119767025 missense probably damaging 0.99
R2207:Zfp131 UTSW 13 119775812 missense probably damaging 1.00
R4342:Zfp131 UTSW 13 119776018 missense probably damaging 0.99
R4852:Zfp131 UTSW 13 119788858 critical splice donor site probably null
R4876:Zfp131 UTSW 13 119788955 missense possibly damaging 0.88
R4990:Zfp131 UTSW 13 119782913 missense probably damaging 1.00
R5979:Zfp131 UTSW 13 119776446 missense probably benign 0.03
R6090:Zfp131 UTSW 13 119775996 missense probably damaging 0.99
R6269:Zfp131 UTSW 13 119766405 missense possibly damaging 0.86
R6791:Zfp131 UTSW 13 119766593 missense probably damaging 0.98
R7147:Zfp131 UTSW 13 119766543 missense probably benign 0.00
R7217:Zfp131 UTSW 13 119775841 missense probably damaging 0.99
R7809:Zfp131 UTSW 13 119788910 missense probably damaging 1.00
R7815:Zfp131 UTSW 13 119775980 missense probably damaging 0.99
R8231:Zfp131 UTSW 13 119775812 missense probably damaging 0.99
R8308:Zfp131 UTSW 13 119782904 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- ACCCGTTCAACGTGAAGCTC -3'
(R):5'- CTGGAGATAAACCCAACCATTGTAC -3'

Sequencing Primer
(F):5'- GAAGCTCTTCAACATGTACTTCAGTG -3'
(R):5'- AAACCCAACCATTGTACTCTGTGTG -3'
Posted On2015-06-12