Incidental Mutation 'R4227:Polh'
ID320112
Institutional Source Beutler Lab
Gene Symbol Polh
Ensembl Gene ENSMUSG00000023953
Gene Namepolymerase (DNA directed), eta (RAD 30 related)
SynonymsRAD30A
MMRRC Submission 041047-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R4227 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46172004-46202625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46172594 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 582 (S582P)
Ref Sequence ENSEMBL: ENSMUSP00000024749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024748] [ENSMUST00000024749] [ENSMUST00000169383] [ENSMUST00000172170]
Predicted Effect probably benign
Transcript: ENSMUST00000024748
SMART Domains Protein: ENSMUSP00000024748
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 412 4.2e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Pfam:GTP_EFTU_D3 499 589 8.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000024749
AA Change: S582P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024749
Gene: ENSMUSG00000023953
AA Change: S582P

DomainStartEndE-ValueType
Pfam:IMS 12 227 9.7e-53 PFAM
Pfam:IMS_C 308 435 5.8e-15 PFAM
low complexity region 515 529 N/A INTRINSIC
low complexity region 540 561 N/A INTRINSIC
PDB:2I5O|A 606 643 7e-15 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000166252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166663
Predicted Effect probably benign
Transcript: ENSMUST00000166701
SMART Domains Protein: ENSMUSP00000131772
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
SCOP:d1f60a2 69 111 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167681
Predicted Effect probably benign
Transcript: ENSMUST00000169383
SMART Domains Protein: ENSMUSP00000133050
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169798
Predicted Effect probably benign
Transcript: ENSMUST00000172170
SMART Domains Protein: ENSMUSP00000128517
Gene: ENSMUSG00000023952

DomainStartEndE-ValueType
low complexity region 26 57 N/A INTRINSIC
Pfam:GTP_EFTU 172 411 9.4e-27 PFAM
low complexity region 418 429 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Y family of specialized DNA polymerases. It copies undamaged DNA with a lower fidelity than other DNA-directed polymerases. However, it accurately replicates UV-damaged DNA; when thymine dimers are present, this polymerase inserts the complementary nucleotides in the newly synthesized DNA, thereby bypassing the lesion and suppressing the mutagenic effect of UV-induced DNA damage. This polymerase is thought to be involved in hypermutation during immunoglobulin class switch recombination. Mutations in this gene result in XPV, a variant type of xeroderma pigmentosum. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous inactivation of this gene causes increased susceptibility to UV-induced skin tumors and results in reduced immunoglobulin gene mutations at A-T base pairs with a G-C biased mutation pattern. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Birc6 T C 17: 74,619,840 probably null Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Gpsm1 T C 2: 26,339,626 probably benign Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Mug2 A T 6: 122,040,732 D476V probably benign Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Odf2 A G 2: 29,901,284 probably benign Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr444 A G 6: 42,955,714 Y72C possibly damaging Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
P3h2 G T 16: 26,105,453 D77E probably benign Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina10 A G 12: 103,628,415 Y182H probably damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Slc17a8 T C 10: 89,598,713 N184S probably damaging Het
Spen C T 4: 141,522,147 S110N unknown Het
Tas1r1 T C 4: 152,028,272 I775V probably damaging Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp131 T C 13: 119,766,746 D455G probably damaging Het
Other mutations in Polh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Polh APN 17 46172243 unclassified probably benign
IGL00585:Polh APN 17 46172243 unclassified probably benign
IGL01812:Polh APN 17 46172911 missense probably benign 0.04
IGL01996:Polh APN 17 46173001 missense probably benign 0.00
IGL02578:Polh APN 17 46194292 nonsense probably null
IGL02829:Polh APN 17 46172902 missense possibly damaging 0.82
IGL03003:Polh APN 17 46194366 missense possibly damaging 0.57
R1435:Polh UTSW 17 46194255 missense probably damaging 1.00
R2091:Polh UTSW 17 46181454 splice site probably benign
R2129:Polh UTSW 17 46188088 nonsense probably null
R4226:Polh UTSW 17 46172594 missense probably benign
R5483:Polh UTSW 17 46172745 missense probably benign 0.01
R5878:Polh UTSW 17 46194325 missense probably damaging 0.99
R6039:Polh UTSW 17 46188033 missense probably benign 0.00
R6039:Polh UTSW 17 46188033 missense probably benign 0.00
R6177:Polh UTSW 17 46184744 missense possibly damaging 0.94
R6345:Polh UTSW 17 46182738 missense probably benign 0.03
R6545:Polh UTSW 17 46182759 missense possibly damaging 0.74
R6712:Polh UTSW 17 46190729 missense probably benign 0.12
R7054:Polh UTSW 17 46198716 missense probably benign 0.24
R7708:Polh UTSW 17 46172700 missense probably benign 0.00
R7855:Polh UTSW 17 46175248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGGTTTTGAAGTACAAGGC -3'
(R):5'- ACCACAGGAAGTCAGTCTTTC -3'

Sequencing Primer
(F):5'- GACTTCTGCAACTCCAATGC -3'
(R):5'- CAGTCTTTCTTTAAGCAGAAGAGCC -3'
Posted On2015-06-12