Mutagenetix > Incidental Mutation

Incidental Mutation 'R0396:Kif16b'

32012

Institutional Source

Beutler Lab

Gene Symbol

Kif16b

Ensembl Gene

ENSMUSG00000038844

Gene Name

kinesin family member 16B

Synonyms

8430434E15Rik, N-3 kinesin

MMRRC Submission

038602-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0396 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

142617474-142901531 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 142853659 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 175 (R175H)

Ref Sequence

ENSEMBL: ENSMUSP00000154926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000211861] [ENSMUST00000230763]

AlphaFold

B1AVY7

Predicted Effect

probably damaging
Transcript: ENSMUST00000043589
AA Change: R175H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844
AA Change: R175H

Domain	Start	End	E-Value	Type
KISc	1	366	4.87e-173	SMART
FHA	477	529	1.43e-1	SMART
coiled coil region	597	809	N/A	INTRINSIC
coiled coil region	835	858	N/A	INTRINSIC
coiled coil region	941	1022	N/A	INTRINSIC
PX	1179	1281	1.58e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000211861
AA Change: R175H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000230763
AA Change: R175H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.8526

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 89.8%

Validation Efficiency

92% (96/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,268,377	V467A	possibly damaging	Het
4933405L10Rik	G	A	8: 105,709,780	V194I	probably benign	Het
Acsm1	A	T	7: 119,636,455	I133F	probably damaging	Het
Adamts9	T	A	6: 92,798,005	T1676S	probably benign	Het
Adcy4	T	C	14: 55,772,288	D769G	probably benign	Het
Aif1	T	C	17: 35,171,109	*148W	probably null	Het
Akna	C	T	4: 63,392,126		probably benign	Het
Arhgap32	G	A	9: 32,245,255		probably null	Het
Atpaf1	G	A	4: 115,785,252	E92K	possibly damaging	Het
C1s1	T	C	6: 124,533,354	E378G	probably benign	Het
Caprin1	T	A	2: 103,769,569	Q108L	probably damaging	Het
Car13	A	T	3: 14,656,239	H154L	probably benign	Het
Cdon	C	A	9: 35,470,130	N605K	probably damaging	Het
Ceacam10	G	A	7: 24,781,014	G70E	probably damaging	Het
Cfap221	G	A	1: 119,954,200	T286M	probably benign	Het
Cfap61	T	C	2: 145,949,944	F107S	possibly damaging	Het
Coil	C	A	11: 88,981,623	T270N	probably benign	Het
Crocc2	T	G	1: 93,224,214		probably benign	Het
Crot	T	C	5: 8,969,959	E461G	probably damaging	Het
D130052B06Rik	G	T	11: 33,623,391	R41L	unknown	Het
D630045J12Rik	T	C	6: 38,196,736	S166G	possibly damaging	Het
Dennd4a	T	G	9: 64,862,391	V460G	probably damaging	Het
Depdc7	A	T	2: 104,727,323		probably benign	Het
Dgkb	G	A	12: 38,190,135		probably null	Het
Dhx57	T	G	17: 80,274,797	S407R	probably benign	Het
Dnase2a	G	T	8: 84,909,763		probably benign	Het
Dqx1	T	G	6: 83,059,005	M106R	probably benign	Het
Eno1b	T	C	18: 48,047,739	I328T	probably benign	Het
Ephx2	T	G	14: 66,108,063	I151L	probably benign	Het
Gdf3	C	T	6: 122,607,135	G91D	probably damaging	Het
Gm14124	G	A	2: 150,268,053	G221D	probably damaging	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gsdme	T	A	6: 50,221,107	H291L	probably benign	Het
H2-Bl	A	G	17: 36,083,722	I103T	possibly damaging	Het
Hif3a	G	A	7: 17,052,021		probably benign	Het
Hmox2	A	T	16: 4,765,763	I232L	probably benign	Het
Itgb2	A	G	10: 77,561,189	Y686C	probably damaging	Het
Jmjd1c	A	G	10: 67,219,523	T528A	possibly damaging	Het
Kdr	T	C	5: 75,960,728	I541V	possibly damaging	Het
Khdrbs2	C	A	1: 32,519,973	V343L	probably damaging	Het
Klri2	T	G	6: 129,740,288	E44A	possibly damaging	Het
Kmt2b	G	T	7: 30,576,755	T1773K	probably damaging	Het
Lair1	A	G	7: 4,010,786	L154P	probably damaging	Het
Larp1b	G	A	3: 40,970,561	V158M	probably damaging	Het
Lgi3	T	A	14: 70,534,840	I275N	probably damaging	Het
Lrba	A	G	3: 86,295,179	N246D	probably damaging	Het
Lrrc45	T	A	11: 120,714,907		probably benign	Het
Mdh2	G	T	5: 135,789,679	V263L	probably benign	Het
Myom1	T	A	17: 71,034,693	V149E	probably damaging	Het
Nanos1	A	T	19: 60,757,041	D259V	probably damaging	Het
Nedd4l	T	A	18: 65,161,654		probably benign	Het
Npas3	A	G	12: 53,831,745	Y150C	probably damaging	Het
Olfr1066	T	C	2: 86,456,019	N84S	possibly damaging	Het
Olfr1129	T	A	2: 87,575,567	V161D	possibly damaging	Het
Olfr1392	A	T	11: 49,293,338	I6F	probably benign	Het
Olfr479	A	T	7: 108,055,963	H327L	probably benign	Het
Olfr672	G	A	7: 104,996,706	A66V	probably damaging	Het
Olfr93	C	T	17: 37,151,555	C139Y	probably damaging	Het
Pde4c	A	G	8: 70,750,076	N637S	probably benign	Het
Pds5b	T	A	5: 150,779,275	V824D	possibly damaging	Het
Pole2	A	T	12: 69,222,386		probably benign	Het
Ppig	C	T	2: 69,735,976		probably benign	Het
Prep	A	G	10: 45,092,676	Y90C	probably damaging	Het
Proca1	A	T	11: 78,194,905	R11S	probably damaging	Het
Prph	T	A	15: 99,056,991	W313R	probably benign	Het
Prune2	C	T	19: 17,123,080	P1983S	probably benign	Het
Ptbp2	G	A	3: 119,724,198		probably benign	Het
Rsph6a	C	T	7: 19,074,106	P398L	probably damaging	Het
Sdk2	T	C	11: 113,829,967	I1379V	probably benign	Het
Sf3b1	C	T	1: 55,019,271	G53E	probably damaging	Het
Slc9a3	T	C	13: 74,157,784		probably null	Het
Smarcal1	A	T	1: 72,626,473	H710L	probably benign	Het
Soat2	GAGAAG	GAG	15: 102,150,707		probably benign	Het
Sptan1	T	C	2: 29,991,033	V438A	probably damaging	Het
Sstr4	T	A	2: 148,396,261	V264D	probably damaging	Het
Susd2	A	G	10: 75,639,911	L418P	probably damaging	Het
Synj1	A	G	16: 90,938,640	V1475A	probably benign	Het
Szt2	G	A	4: 118,376,347		probably benign	Het
Tbc1d4	T	C	14: 101,458,063		probably null	Het
Tesk1	A	G	4: 43,446,000	E311G	probably damaging	Het
Tmed5	A	T	5: 108,126,016	V119E	probably damaging	Het
Tmem260	T	C	14: 48,486,867	S201P	possibly damaging	Het
Tnxb	A	G	17: 34,671,733	Y350C	probably damaging	Het
Tpte	T	C	8: 22,335,608		probably benign	Het
Trim37	A	T	11: 87,146,968	D161V	probably damaging	Het
Trrap	C	A	5: 144,814,556	Q1640K	probably damaging	Het
Tspoap1	T	C	11: 87,776,346		probably benign	Het
Ttk	T	A	9: 83,847,260		probably benign	Het
Vmn1r172	A	G	7: 23,660,532	S281G	probably benign	Het
Vmn1r177	A	G	7: 23,865,597	S285P	probably damaging	Het
Vmn1r231	C	T	17: 20,890,399	V85I	probably damaging	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r118	T	C	17: 55,608,643	I436V	probably benign	Het
Vmn2r12	T	C	5: 109,092,899	K116R	probably benign	Het
Vmn2r28	T	A	7: 5,488,514	I245L	probably benign	Het
Wdr26	A	T	1: 181,180,651		probably benign	Het
Xrcc3	A	T	12: 111,809,957	H67Q	probably benign	Het
Zbbx	A	T	3: 75,078,495	S417T	possibly damaging	Het
Zc3h13	A	G	14: 75,323,482	D504G	unknown	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zyg11b	A	T	4: 108,255,308	F388I	probably damaging	Het

Other mutations in Kif16b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Kif16b	APN	2	142848035	nonsense	probably null
IGL00499:Kif16b	APN	2	142857324	missense	probably damaging	1.00
IGL00913:Kif16b	APN	2	142704007	nonsense	probably null
IGL00971:Kif16b	APN	2	142711744	missense	probably benign	0.01
IGL01712:Kif16b	APN	2	142648471	missense	probably damaging	1.00
IGL01965:Kif16b	APN	2	142848405	missense	probably damaging	1.00
IGL02428:Kif16b	APN	2	142672360	missense	possibly damaging	0.88
IGL02576:Kif16b	APN	2	142862545	splice site	probably benign
IGL02884:Kif16b	APN	2	142702614	splice site	probably benign
IGL03065:Kif16b	APN	2	142619913	missense	probably damaging	1.00
IGL03103:Kif16b	APN	2	142862488	missense	probably damaging	1.00
IGL03403:Kif16b	APN	2	142711869	missense	probably damaging	1.00
IGL02835:Kif16b	UTSW	2	142712213	missense	probably benign	0.00
R0058:Kif16b	UTSW	2	142857305	splice site	probably null
R0058:Kif16b	UTSW	2	142857305	splice site	probably null
R0081:Kif16b	UTSW	2	142707426	splice site	probably benign
R0123:Kif16b	UTSW	2	142672375	missense	probably benign
R0134:Kif16b	UTSW	2	142672375	missense	probably benign
R0388:Kif16b	UTSW	2	142740937	missense	probably damaging	1.00
R0502:Kif16b	UTSW	2	142712155	missense	probably benign	0.00
R1027:Kif16b	UTSW	2	142854538	splice site	probably benign
R1674:Kif16b	UTSW	2	142712953	nonsense	probably null
R1752:Kif16b	UTSW	2	142690666	missense	probably benign	0.01
R2154:Kif16b	UTSW	2	142690580	missense	probably damaging	1.00
R2262:Kif16b	UTSW	2	142740917	missense	probably damaging	1.00
R2401:Kif16b	UTSW	2	142756122	missense	probably benign	0.04
R3951:Kif16b	UTSW	2	142707359	missense	probably benign	0.01
R4161:Kif16b	UTSW	2	142707404	missense	probably benign	0.00
R4697:Kif16b	UTSW	2	142690694	missense	probably benign	0.09
R4747:Kif16b	UTSW	2	142857426	missense	probably damaging	1.00
R4808:Kif16b	UTSW	2	142857358	missense	probably damaging	1.00
R4878:Kif16b	UTSW	2	142848003	missense	probably damaging	1.00
R5068:Kif16b	UTSW	2	142711707	missense	probably benign
R5120:Kif16b	UTSW	2	142848339	missense	probably damaging	1.00
R5358:Kif16b	UTSW	2	142740969	missense	probably damaging	1.00
R5821:Kif16b	UTSW	2	142702666	missense	probably damaging	1.00
R5833:Kif16b	UTSW	2	142707367	missense	probably benign
R5882:Kif16b	UTSW	2	142707258	critical splice donor site	probably null
R5974:Kif16b	UTSW	2	142857381	missense	probably damaging	1.00
R6043:Kif16b	UTSW	2	142711900	missense	probably damaging	1.00
R6230:Kif16b	UTSW	2	142849912	missense	probably damaging	1.00
R6373:Kif16b	UTSW	2	142699698	missense	possibly damaging	0.91
R6472:Kif16b	UTSW	2	142699948	intron	probably benign
R6622:Kif16b	UTSW	2	142712442	missense	probably benign	0.01
R6654:Kif16b	UTSW	2	142701277	intron	probably benign
R6912:Kif16b	UTSW	2	142700099	intron	probably benign
R7003:Kif16b	UTSW	2	142758829	missense	possibly damaging	0.95
R7265:Kif16b	UTSW	2	142714730	missense	probably damaging	1.00
R7307:Kif16b	UTSW	2	142712931	missense	probably benign	0.00
R7376:Kif16b	UTSW	2	142711872	missense	probably damaging	0.99
R7381:Kif16b	UTSW	2	142857423	missense	probably damaging	1.00
R7558:Kif16b	UTSW	2	142758826	missense	probably damaging	1.00
R7681:Kif16b	UTSW	2	142756126	missense	probably damaging	1.00
R7896:Kif16b	UTSW	2	142834075	critical splice donor site	probably null
R7956:Kif16b	UTSW	2	142862470	missense	probably benign	0.00
R8053:Kif16b	UTSW	2	142853714	missense	probably damaging	1.00
R8056:Kif16b	UTSW	2	142712842	missense	probably damaging	1.00
R8139:Kif16b	UTSW	2	142901365	missense	probably benign	0.00
R8182:Kif16b	UTSW	2	142712899	missense	possibly damaging	0.90
R8224:Kif16b	UTSW	2	142834088	missense	probably benign	0.03
R8357:Kif16b	UTSW	2	142711908	missense	probably damaging	1.00
R8359:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8360:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8369:Kif16b	UTSW	2	142711857	missense	probably benign	0.05
R8385:Kif16b	UTSW	2	142712338	missense	probably benign	0.09
R8457:Kif16b	UTSW	2	142711908	missense	probably damaging	1.00
R8720:Kif16b	UTSW	2	142849872	missense	probably damaging	1.00
R8898:Kif16b	UTSW	2	142712979	missense	possibly damaging	0.81
R8987:Kif16b	UTSW	2	142849863	critical splice donor site	probably null
R8987:Kif16b	UTSW	2	142901358	missense	probably benign	0.00
R9022:Kif16b	UTSW	2	142712617	missense	possibly damaging	0.46
R9040:Kif16b	UTSW	2	142849878	missense	probably benign	0.02
R9044:Kif16b	UTSW	2	142699657	missense	possibly damaging	0.91
R9138:Kif16b	UTSW	2	142700556	missense
R9167:Kif16b	UTSW	2	142700920	nonsense	probably null
R9218:Kif16b	UTSW	2	142699663	missense	possibly damaging	0.77
R9283:Kif16b	UTSW	2	142712980	missense	probably benign	0.00
R9300:Kif16b	UTSW	2	142699287	missense	probably benign
R9378:Kif16b	UTSW	2	142619818	nonsense	probably null
R9522:Kif16b	UTSW	2	142849907	missense	probably damaging	0.96
R9588:Kif16b	UTSW	2	142711884	missense	possibly damaging	0.82
R9632:Kif16b	UTSW	2	142712040	missense	probably benign	0.00
R9641:Kif16b	UTSW	2	142700669	missense	probably benign	0.01
X0058:Kif16b	UTSW	2	142758861	missense	probably damaging	1.00
Z1177:Kif16b	UTSW	2	142711824	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGCATTGCCACTGAGACACACAGG -3'
(R):5'- CAGTAAGCCGTTGCAAGGGTTGAG -3'

Sequencing Primer
(F):5'- GGGGTCAGAACTTGATCGTC -3'
(R):5'- TGCAAGGGTTGAGTGAAATACTTC -3'

Posted On

2013-04-24