Incidental Mutation 'R4229:Gm27013'
ID320126
Institutional Source Beutler Lab
Gene Symbol Gm27013
Ensembl Gene ENSMUSG00000098025
Gene Namepredicted gene, 27013
Synonyms
MMRRC Submission 041048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R4229 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location130519764-130546306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130677345 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 385 (S385T)
Gene Model predicted gene model for transcript(s):
Predicted Effect possibly damaging
Transcript: ENSMUST00000182643
AA Change: S385T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138716
Gene: ENSMUSG00000098137
AA Change: S385T

DomainStartEndE-ValueType
KRAB 8 68 3.39e-35 SMART
ZnF_C2H2 453 503 1.83e2 SMART
ZnF_C2H2 509 531 6.99e-5 SMART
ZnF_C2H2 537 559 1.4e-4 SMART
ZnF_C2H2 565 587 1.6e-4 SMART
ZnF_C2H2 593 615 1.08e-5 SMART
ZnF_C2H2 621 643 1.2e-3 SMART
ZnF_C2H2 649 671 1.5e-4 SMART
ZnF_C2H2 677 699 1.58e-3 SMART
ZnF_C2H2 705 727 2.61e-4 SMART
ZnF_C2H2 733 755 4.79e-3 SMART
ZnF_C2H2 761 783 4.61e-5 SMART
ZnF_C2H2 789 811 1.13e-4 SMART
ZnF_C2H2 817 839 3.16e-3 SMART
ZnF_C2H2 845 867 1.28e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205067
Meta Mutation Damage Score 0.0812 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Aadac A G 3: 60,031,813 K3E possibly damaging Het
Cdc14a A G 3: 116,293,764 S533P probably damaging Het
Dsc3 G A 18: 19,965,821 T767I probably damaging Het
Dse A T 10: 34,162,744 M221K probably damaging Het
Etfb C A 7: 43,456,560 R174S probably damaging Het
Gm10735 T C 13: 113,041,209 probably benign Het
Gsap A G 5: 21,246,977 D339G probably benign Het
H2-T24 G A 17: 36,014,829 A290V probably benign Het
Ifi44l A T 3: 151,762,877 C5* probably null Het
Lipk A G 19: 34,020,287 Y56C probably damaging Het
Mrpl21 A G 19: 3,286,901 I91V probably damaging Het
Nin T C 12: 70,051,210 E492G probably damaging Het
Nxpe4 A G 9: 48,392,822 R70G possibly damaging Het
Olfr1179 T A 2: 88,402,883 Q17L possibly damaging Het
Olfr1280 A G 2: 111,316,336 I286V probably damaging Het
Olfr20 A T 11: 73,354,232 T160S probably damaging Het
Olfr670 A T 7: 104,960,594 I46N probably benign Het
Plaur T C 7: 24,466,783 V93A probably damaging Het
Ptprv C A 1: 135,126,207 noncoding transcript Het
Rabep1 A G 11: 70,908,434 T295A probably benign Het
Sec24b G T 3: 130,040,719 Q141K probably benign Het
Set A G 2: 30,069,519 Y139C probably damaging Het
Sspo T C 6: 48,490,934 S4272P probably benign Het
Tmc3 T C 7: 83,597,402 probably benign Het
Tmem229a T A 6: 24,954,832 I308F probably damaging Het
Vmn1r223 A T 13: 23,249,415 M60L probably benign Het
Zfp148 A G 16: 33,434,763 E41G probably benign Het
Zfp677 T C 17: 21,398,282 S534P probably damaging Het
Other mutations in Gm27013
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4175:Gm27013 UTSW 6 130677147 missense probably benign 0.00
R4408:Gm27013 UTSW 6 130677765 missense possibly damaging 0.90
R4585:Gm27013 UTSW 6 130521040 unclassified noncoding transcript
R4586:Gm27013 UTSW 6 130521040 unclassified noncoding transcript
R4823:Gm27013 UTSW 6 130522223 exon noncoding transcript
R4840:Gm27013 UTSW 6 130678116 missense probably benign 0.00
R4842:Gm27013 UTSW 6 130520737 unclassified noncoding transcript
R4943:Gm27013 UTSW 6 130676200 nonsense probably null
R4998:Gm27013 UTSW 6 130676538 missense probably damaging 0.98
R5087:Gm27013 UTSW 6 130677670 missense probably damaging 0.98
R5271:Gm27013 UTSW 6 130676915 missense probably damaging 1.00
R5507:Gm27013 UTSW 6 130675979 missense probably damaging 1.00
R5767:Gm27013 UTSW 6 130675958 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TAAGCTTGAAGATTTGAGGACTGG -3'
(R):5'- GCAACAAAACCTACTCAGTGTTAAG -3'

Sequencing Primer
(F):5'- TGAGGACTGGATAAATGAGTTCTC -3'
(R):5'- CCTACTCAGTGTTAAGGAATATGATG -3'
Posted On2015-06-12