Incidental Mutation 'R4229:Olfr670'
ID320130
Institutional Source Beutler Lab
Gene Symbol Olfr670
Ensembl Gene ENSMUSG00000044705
Gene Nameolfactory receptor 670
SynonymsMOR32-8, GA_x6K02T2PBJ9-7589577-7588639
MMRRC Submission 041048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4229 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104957114-104962620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104960594 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 46 (I46N)
Ref Sequence ENSEMBL: ENSMUSP00000151138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050482] [ENSMUST00000214216]
Predicted Effect probably benign
Transcript: ENSMUST00000050482
AA Change: I46N

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000060289
Gene: ENSMUSG00000044705
AA Change: I46N

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 3.7e-121 PFAM
Pfam:7TM_GPCR_Srsx 37 211 4.5e-7 PFAM
Pfam:7tm_1 43 293 3.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214216
AA Change: I46N

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Aadac A G 3: 60,031,813 K3E possibly damaging Het
Cdc14a A G 3: 116,293,764 S533P probably damaging Het
Dsc3 G A 18: 19,965,821 T767I probably damaging Het
Dse A T 10: 34,162,744 M221K probably damaging Het
Etfb C A 7: 43,456,560 R174S probably damaging Het
Gm10735 T C 13: 113,041,209 probably benign Het
Gm27013 A T 6: 130,677,345 S385T possibly damaging Het
Gsap A G 5: 21,246,977 D339G probably benign Het
H2-T24 G A 17: 36,014,829 A290V probably benign Het
Ifi44l A T 3: 151,762,877 C5* probably null Het
Lipk A G 19: 34,020,287 Y56C probably damaging Het
Mrpl21 A G 19: 3,286,901 I91V probably damaging Het
Nin T C 12: 70,051,210 E492G probably damaging Het
Nxpe4 A G 9: 48,392,822 R70G possibly damaging Het
Olfr1179 T A 2: 88,402,883 Q17L possibly damaging Het
Olfr1280 A G 2: 111,316,336 I286V probably damaging Het
Olfr20 A T 11: 73,354,232 T160S probably damaging Het
Plaur T C 7: 24,466,783 V93A probably damaging Het
Ptprv C A 1: 135,126,207 noncoding transcript Het
Rabep1 A G 11: 70,908,434 T295A probably benign Het
Sec24b G T 3: 130,040,719 Q141K probably benign Het
Set A G 2: 30,069,519 Y139C probably damaging Het
Sspo T C 6: 48,490,934 S4272P probably benign Het
Tmc3 T C 7: 83,597,402 probably benign Het
Tmem229a T A 6: 24,954,832 I308F probably damaging Het
Vmn1r223 A T 13: 23,249,415 M60L probably benign Het
Zfp148 A G 16: 33,434,763 E41G probably benign Het
Zfp677 T C 17: 21,398,282 S534P probably damaging Het
Other mutations in Olfr670
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Olfr670 APN 7 104960716 missense probably damaging 0.96
IGL01100:Olfr670 APN 7 104959995 missense probably benign 0.07
IGL01351:Olfr670 APN 7 104960739 start gained probably benign
IGL01478:Olfr670 APN 7 104960348 missense probably damaging 0.97
IGL01835:Olfr670 APN 7 104960462 missense probably benign 0.01
IGL02326:Olfr670 APN 7 104960646 missense probably benign 0.12
IGL02434:Olfr670 APN 7 104960072 missense probably benign 0.05
IGL02434:Olfr670 APN 7 104960074 nonsense probably null
IGL02968:Olfr670 APN 7 104960244 missense possibly damaging 0.90
R0055:Olfr670 UTSW 7 104960496 missense possibly damaging 0.46
R0055:Olfr670 UTSW 7 104960496 missense possibly damaging 0.46
R0345:Olfr670 UTSW 7 104960181 missense probably damaging 1.00
R0401:Olfr670 UTSW 7 104959943 missense probably damaging 1.00
R0646:Olfr670 UTSW 7 104959811 missense probably benign 0.02
R1493:Olfr670 UTSW 7 104960502 missense probably damaging 0.97
R1532:Olfr670 UTSW 7 104960265 missense probably benign
R1557:Olfr670 UTSW 7 104960540 missense probably damaging 0.99
R4072:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4074:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4075:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4076:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4230:Olfr670 UTSW 7 104960594 missense probably benign 0.18
R5374:Olfr670 UTSW 7 104959996 missense probably damaging 1.00
R6006:Olfr670 UTSW 7 104960663 missense probably damaging 0.99
R6891:Olfr670 UTSW 7 104959985 missense probably damaging 1.00
R7465:Olfr670 UTSW 7 104959917 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTCTCCATTGCAGTGAATATGTG -3'
(R):5'- ACACATTTCAAATGGTTGTGGG -3'

Sequencing Primer
(F):5'- CCATTGCAGTGAATATGTGGATGAAG -3'
(R):5'- TGGAACTGAATTCCACCC -3'
Posted On2015-06-12