Incidental Mutation 'R4240:Ddi1'
ID320174
Institutional Source Beutler Lab
Gene Symbol Ddi1
Ensembl Gene ENSMUSG00000047619
Gene NameDNA-damage inducible 1
Synonyms
MMRRC Submission 041057-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R4240 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location6262733-6269846 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6265799 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 190 (M190T)
Ref Sequence ENSEMBL: ENSMUSP00000053223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051706] [ENSMUST00000058692] [ENSMUST00000168039] [ENSMUST00000214892]
PDB Structure
Solution Structure of the Ubiquitin-like Domain from Mouse Hypothetical 1700011N24Rik Protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000051706
AA Change: M190T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053223
Gene: ENSMUSG00000047619
AA Change: M190T

DomainStartEndE-ValueType
UBQ 3 77 4.57e-1 SMART
low complexity region 111 123 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
Pfam:Asp_protease 226 349 3.3e-63 PFAM
Pfam:RVP_2 229 362 3.6e-8 PFAM
Pfam:RVP 250 349 2.5e-8 PFAM
Pfam:Asp_protease_2 252 340 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058692
SMART Domains Protein: ENSMUSP00000056240
Gene: ENSMUSG00000032006

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CUB 48 164 5.38e-25 SMART
PDGF 265 358 4.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168039
SMART Domains Protein: ENSMUSP00000128388
Gene: ENSMUSG00000032006

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CUB 54 170 5.38e-25 SMART
PDGF 271 364 4.58e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214892
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 93% (50/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,591 I262V possibly damaging Het
4833420G17Rik C T 13: 119,466,942 P93S probably benign Het
4930488N24Rik A T 17: 14,105,787 noncoding transcript Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Ceacam3 G A 7: 17,160,024 E487K possibly damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Cnot6l T C 5: 96,077,362 T491A probably benign Het
Cog7 C T 7: 121,925,484 V696M possibly damaging Het
Col22a1 C T 15: 72,007,131 G59D probably damaging Het
Eno1b T A 18: 48,047,840 S362T probably benign Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fam170a A T 18: 50,281,667 M127L possibly damaging Het
Gm17677 T A 9: 35,742,153 Y84* probably null Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Hsf4 A G 8: 105,274,881 T378A possibly damaging Het
Irf2bpl C A 12: 86,882,917 Q327H possibly damaging Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Kmt2d G A 15: 98,844,571 probably benign Het
Lad1 T A 1: 135,827,295 V103D possibly damaging Het
Mcm4 A T 16: 15,627,706 Y692* probably null Het
Med15 C T 16: 17,655,494 R497H probably damaging Het
Mfrp T C 9: 44,102,866 V177A possibly damaging Het
Mr1 T C 1: 155,136,667 E167G probably damaging Het
Myo18b A G 5: 112,803,187 probably null Het
Myom2 A G 8: 15,132,895 D1444G probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Nlrp4d A T 7: 10,381,316 H479Q noncoding transcript Het
Nphp4 A G 4: 152,555,684 D1009G probably benign Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Rdh7 T C 10: 127,885,802 I202V probably benign Het
Rsf1 C CGGCGGCGGT 7: 97,579,935 probably benign Het
Sgsm3 A G 15: 81,011,782 probably benign Het
Sipa1l2 T C 8: 125,491,656 E314G probably benign Het
Slc8a3 T C 12: 81,315,176 K290E probably damaging Het
Tbc1d17 T C 7: 44,846,826 Y84C probably damaging Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Vmn2r8 A T 5: 108,797,503 V746D probably damaging Het
Xdh A G 17: 73,895,795 V1120A possibly damaging Het
Zbtb38 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 9: 96,686,102 probably benign Het
Zfp791 T C 8: 85,109,666 H523R probably null Het
Zfp870 A G 17: 32,885,736 I53T probably benign Het
Other mutations in Ddi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Ddi1 APN 9 6265773 missense probably damaging 0.97
IGL01977:Ddi1 APN 9 6266226 missense probably benign 0.01
IGL02260:Ddi1 APN 9 6265760 missense probably benign
IGL02543:Ddi1 APN 9 6266183 missense possibly damaging 0.79
IGL02678:Ddi1 APN 9 6266106 missense probably benign
R0482:Ddi1 UTSW 9 6266144 missense probably damaging 0.96
R1313:Ddi1 UTSW 9 6265769 missense probably damaging 0.99
R1313:Ddi1 UTSW 9 6265769 missense probably damaging 0.99
R1588:Ddi1 UTSW 9 6265391 missense probably damaging 0.98
R1605:Ddi1 UTSW 9 6266012 missense probably benign 0.02
R1671:Ddi1 UTSW 9 6266225 missense possibly damaging 0.81
R4237:Ddi1 UTSW 9 6265799 missense probably benign 0.00
R4239:Ddi1 UTSW 9 6265799 missense probably benign 0.00
R4588:Ddi1 UTSW 9 6266003 missense probably benign 0.15
R4790:Ddi1 UTSW 9 6265761 missense probably benign 0.00
R4950:Ddi1 UTSW 9 6266073 missense probably benign 0.04
R5626:Ddi1 UTSW 9 6266003 missense probably benign
R7413:Ddi1 UTSW 9 6265670 missense probably damaging 1.00
R8052:Ddi1 UTSW 9 6265787 missense probably benign
R8260:Ddi1 UTSW 9 6265524 missense probably damaging 1.00
R8285:Ddi1 UTSW 9 6265808 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTCATGATAGTCATCTGGGC -3'
(R):5'- ACGGATTAGCCTCTGGAGAG -3'

Sequencing Primer
(F):5'- AAGGATGCCCATTCACTTTGCAG -3'
(R):5'- CCTCTGGAGAGAATATGACCTTTGC -3'
Posted On2015-06-12