Incidental Mutation 'R4240:Erbb2'
ID320181
Institutional Source Beutler Lab
Gene Symbol Erbb2
Ensembl Gene ENSMUSG00000062312
Gene Nameerb-b2 receptor tyrosine kinase 2
Synonymsc-erbB2, c-neu, HER-2, HER2, Neu, ErbB-2, Neu oncogene
MMRRC Submission 041057-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4240 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98412470-98437716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98428043 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 549 (K549R)
Ref Sequence ENSEMBL: ENSMUSP00000053897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058295]
Predicted Effect probably benign
Transcript: ENSMUST00000058295
AA Change: K549R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000053897
Gene: ENSMUSG00000062312
AA Change: K549R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Recep_L_domain 52 174 2e-32 PFAM
FU 190 231 1.88e1 SMART
FU 233 276 1.03e-6 SMART
Pfam:Recep_L_domain 367 487 2.3e-23 PFAM
FU 502 551 3.08e-5 SMART
FU 558 607 3.97e-8 SMART
transmembrane domain 654 676 N/A INTRINSIC
TyrKc 721 977 1.28e-126 SMART
low complexity region 1040 1080 N/A INTRINSIC
low complexity region 1148 1163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158598
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit degeneration of motor nerves, an absence of Schwann cells, impairment of junctional folds at the neuromuscular synapse, and cardiac defects that results in lethality by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310050C09Rik T C 3: 92,868,591 I262V possibly damaging Het
4833420G17Rik C T 13: 119,466,942 P93S probably benign Het
4930488N24Rik A T 17: 14,105,787 noncoding transcript Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Ceacam3 G A 7: 17,160,024 E487K possibly damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Cnot6l T C 5: 96,077,362 T491A probably benign Het
Cog7 C T 7: 121,925,484 V696M possibly damaging Het
Col22a1 C T 15: 72,007,131 G59D probably damaging Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Eno1b T A 18: 48,047,840 S362T probably benign Het
Fam170a A T 18: 50,281,667 M127L possibly damaging Het
Gm17677 T A 9: 35,742,153 Y84* probably null Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Hsf4 A G 8: 105,274,881 T378A possibly damaging Het
Irf2bpl C A 12: 86,882,917 Q327H possibly damaging Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Kmt2d G A 15: 98,844,571 probably benign Het
Lad1 T A 1: 135,827,295 V103D possibly damaging Het
Mcm4 A T 16: 15,627,706 Y692* probably null Het
Med15 C T 16: 17,655,494 R497H probably damaging Het
Mfrp T C 9: 44,102,866 V177A possibly damaging Het
Mr1 T C 1: 155,136,667 E167G probably damaging Het
Myo18b A G 5: 112,803,187 probably null Het
Myom2 A G 8: 15,132,895 D1444G probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Nlrp4d A T 7: 10,381,316 H479Q noncoding transcript Het
Nphp4 A G 4: 152,555,684 D1009G probably benign Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Prc1 G A 7: 80,311,216 probably benign Het
Rdh7 T C 10: 127,885,802 I202V probably benign Het
Rsf1 C CGGCGGCGGT 7: 97,579,935 probably benign Het
Sgsm3 A G 15: 81,011,782 probably benign Het
Sipa1l2 T C 8: 125,491,656 E314G probably benign Het
Slc8a3 T C 12: 81,315,176 K290E probably damaging Het
Tbc1d17 T C 7: 44,846,826 Y84C probably damaging Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Vmn2r8 A T 5: 108,797,503 V746D probably damaging Het
Xdh A G 17: 73,895,795 V1120A possibly damaging Het
Zbtb38 CTCTTCTTCTTCTTCTTCTTCTTC CTCTTCTTCTTCTTCTTCTTC 9: 96,686,102 probably benign Het
Zfp791 T C 8: 85,109,666 H523R probably null Het
Zfp870 A G 17: 32,885,736 I53T probably benign Het
Other mutations in Erbb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Erbb2 APN 11 98435630 missense probably damaging 1.00
IGL01460:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01483:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01514:Erbb2 APN 11 98432919 missense possibly damaging 0.94
IGL01520:Erbb2 APN 11 98434009 missense probably benign 0.05
IGL03007:Erbb2 APN 11 98428993 splice site probably benign
IGL03367:Erbb2 APN 11 98422875 splice site probably null
Angular UTSW 11 98422770 missense probably damaging 0.98
PIT4544001:Erbb2 UTSW 11 98421039 missense probably benign
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0388:Erbb2 UTSW 11 98427351 missense possibly damaging 0.66
R0602:Erbb2 UTSW 11 98434271 missense probably damaging 1.00
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1500:Erbb2 UTSW 11 98428978 missense probably damaging 1.00
R1651:Erbb2 UTSW 11 98433457 missense probably damaging 1.00
R1748:Erbb2 UTSW 11 98435335 missense probably benign 0.06
R1807:Erbb2 UTSW 11 98428854 missense probably damaging 1.00
R1861:Erbb2 UTSW 11 98412737 critical splice donor site probably null
R1926:Erbb2 UTSW 11 98425164 missense probably benign
R1998:Erbb2 UTSW 11 98428953 missense probably damaging 1.00
R2051:Erbb2 UTSW 11 98420172 missense probably damaging 1.00
R3147:Erbb2 UTSW 11 98434039 missense probably damaging 1.00
R4022:Erbb2 UTSW 11 98435297 missense probably benign 0.09
R4238:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4239:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4633:Erbb2 UTSW 11 98432988 missense possibly damaging 0.91
R4725:Erbb2 UTSW 11 98425144 missense possibly damaging 0.71
R5093:Erbb2 UTSW 11 98427453 missense probably damaging 1.00
R5306:Erbb2 UTSW 11 98428206 missense probably benign 0.44
R5375:Erbb2 UTSW 11 98433412 missense probably damaging 1.00
R5518:Erbb2 UTSW 11 98422770 missense probably damaging 0.98
R5710:Erbb2 UTSW 11 98427080 missense probably damaging 1.00
R5938:Erbb2 UTSW 11 98435571 missense probably damaging 0.99
R6062:Erbb2 UTSW 11 98433249 missense probably damaging 1.00
R6116:Erbb2 UTSW 11 98427399 missense probably damaging 1.00
R6514:Erbb2 UTSW 11 98420146 missense probably benign 0.03
R6556:Erbb2 UTSW 11 98436082 missense possibly damaging 0.92
R6570:Erbb2 UTSW 11 98423047 missense possibly damaging 0.88
R6578:Erbb2 UTSW 11 98428188 missense probably damaging 1.00
R7141:Erbb2 UTSW 11 98427309 missense probably damaging 1.00
R7686:Erbb2 UTSW 11 98435573 missense probably benign
X0028:Erbb2 UTSW 11 98434301 missense probably damaging 1.00
X0062:Erbb2 UTSW 11 98423120 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCATGTTCTAGCACCAACCC -3'
(R):5'- TCTCCGAGCTGTTTTGAGGC -3'

Sequencing Primer
(F):5'- TGGAGCCATGCTTACAGC -3'
(R):5'- AGCTGTTTTGAGGCTGACACTC -3'
Posted On2015-06-12