Mutagenetix > Incidental Mutation

Incidental Mutation 'R4240:Slc8a3'

320182

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

041057-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4240 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 81315176 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 290 (K290E)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

AlphaFold

S4R2P9

Predicted Effect

probably benign
Transcript: ENSMUST00000064594
AA Change: K290E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: K290E

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085238
AA Change: K290E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: K290E

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182208
AA Change: K290E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: K290E

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183102

Meta Mutation Damage Score

0.0855

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.7%

Validation Efficiency

93% (50/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310050C09Rik	T	C	3: 92,868,591	I262V	possibly damaging	Het
4833420G17Rik	C	T	13: 119,466,942	P93S	probably benign	Het
4930488N24Rik	A	T	17: 14,105,787		noncoding transcript	Het
Areg	A	T	5: 91,143,516	N106I	probably damaging	Het
Ceacam3	G	A	7: 17,160,024	E487K	possibly damaging	Het
Cfap46	G	T	7: 139,666,287	Q387K	possibly damaging	Het
Cfap74	C	A	4: 155,463,072	H1238Q	probably benign	Het
Cnot6l	T	C	5: 96,077,362	T491A	probably benign	Het
Cog7	C	T	7: 121,925,484	V696M	possibly damaging	Het
Col22a1	C	T	15: 72,007,131	G59D	probably damaging	Het
Ddi1	A	G	9: 6,265,799	M190T	probably benign	Het
Eno1b	T	A	18: 48,047,840	S362T	probably benign	Het
Erbb2	A	G	11: 98,428,043	K549R	probably benign	Het
Fam170a	A	T	18: 50,281,667	M127L	possibly damaging	Het
Gm17677	T	A	9: 35,742,153	Y84*	probably null	Het
Gm1979	T	C	5: 26,001,121	T154A	probably benign	Het
Gm6871	G	T	7: 41,545,780	T511K	probably damaging	Het
Hsf4	A	G	8: 105,274,881	T378A	possibly damaging	Het
Irf2bpl	C	A	12: 86,882,917	Q327H	possibly damaging	Het
Klk6	A	G	7: 43,829,173	H168R	probably benign	Het
Kmt2d	G	A	15: 98,844,571		probably benign	Het
Lad1	T	A	1: 135,827,295	V103D	possibly damaging	Het
Mcm4	A	T	16: 15,627,706	Y692*	probably null	Het
Med15	C	T	16: 17,655,494	R497H	probably damaging	Het
Mfrp	T	C	9: 44,102,866	V177A	possibly damaging	Het
Mr1	T	C	1: 155,136,667	E167G	probably damaging	Het
Myo18b	A	G	5: 112,803,187		probably null	Het
Myom2	A	G	8: 15,132,895	D1444G	probably benign	Het
Nes	C	A	3: 87,979,359	P1598T	probably damaging	Het
Nlrp4d	A	T	7: 10,381,316	H479Q	noncoding transcript	Het
Nphp4	A	G	4: 152,555,684	D1009G	probably benign	Het
Olfr539	A	G	7: 140,667,583	N99D	probably benign	Het
Phactr1	T	A	13: 43,094,887	N437K	possibly damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Prc1	G	A	7: 80,311,216		probably benign	Het
Rdh7	T	C	10: 127,885,802	I202V	probably benign	Het
Rsf1	C	CGGCGGCGGT	7: 97,579,935		probably benign	Het
Sgsm3	A	G	15: 81,011,782		probably benign	Het
Sipa1l2	T	C	8: 125,491,656	E314G	probably benign	Het
Tbc1d17	T	C	7: 44,846,826	Y84C	probably damaging	Het
Usp46	T	G	5: 74,032,267		probably benign	Het
Vmn2r14	T	G	5: 109,216,411		probably null	Het
Vmn2r8	A	T	5: 108,797,503	V746D	probably damaging	Het
Xdh	A	G	17: 73,895,795	V1120A	possibly damaging	Het
Zbtb38	CTCTTCTTCTTCTTCTTCTTCTTC	CTCTTCTTCTTCTTCTTCTTC	9: 96,686,102		probably benign	Het
Zfp791	T	C	8: 85,109,666	H523R	probably null	Het
Zfp870	A	G	17: 32,885,736	I53T	probably benign	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TATTGCCCGCACCAGTCATC -3'
(R):5'- TTTGGGAAGGCCTCCTTACTC -3'

Sequencing Primer
(F):5'- TAGAAAGCACGGCTCTTCTG -3'
(R):5'- GGGAAGGCCTCCTTACTCTCTTC -3'

Posted On

2015-06-12